Description :
From Genome Similarity Track
Location :
Scaffold_407:59146- 60849
Sequence
1703 bases(100 bases per row)
TGGTCCTGGAACAGCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATAACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCA
CATTTCCCGGCGAATAACCTCTCAACTGTGGCTTGCTCTTACTGGTATTGCAGTCTTCGCAGGCTCTAACATGTTTCACCACGTCGGCGTACAGACCAAT
CCAGTAGTAGTCGGCTTTGACTCGGTGATAAGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATG
GTTGACGGTATCACCAATCTCAATGAAAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTACAACAGGTCGTCTTCGCTGAGTA
CAAAGAATTCTGCGACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTTCTCCACTTCACCTCTCAGGTACGCCCGATCTGAGATCGGCCCACCTGA
GTTCTTCATCTTGTGCCTTCGCGATTCATCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCTGGACTGACTCCAT
CTGCGACCTTGTTTCGACATTCGGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCCGCTGACTTGTTCGAATTCATCTCCACTACTTTCAAACGCGGAT
TCTCCAGGATTTGTAGACATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTACATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTC
GGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGGGATGTCTGTGTCGTACAGGTCTTCGGCTACTCGGTTAATCATTCTCAGCTCTGCTTTCCT
ATCCGTCCCAAGAATTACTCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGG
ACCGAGTTGAGTTGTTTCGTGAGATCCTTGTGCCGAGCTAGTTCCACTTGCAACGTTTCCTTCTTGCATGCTATCACCCCCATGGATTGCTGGTTTGCAA
GCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCTGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGT
GGACGACAGGTACGCACTCGCAGCAATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCCGTCTT
CGCTGAGCCATCAAATGACCGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGGTCCATTCGAAACTGTCGCCGAGTTCTTGG
AGGGGGGTGCCAGGTGCTTCAAGGAATCGTCGAGTCCCGATAAACGGGGTGATCGACGGCCTGGAGCAACTGGGGCGAAGTCTACATCTCGCTCACGGAA
CTCGGTTTCACCTTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTGGACTTTAAACACCCACTTCTAGCGTGG
AGAAACGGAGGGAGACGTGAAGGAGGCCTTTTCCCGGCCCACGAAGAGTGATGGCAAAGATTTTCGGCAATTTGCAATAGGCGCGGGATACTTTTCTTTC
TCA