Description :
From Genome Similarity Track
Location :
Scaffold_254:5914- 8360
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.0Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_254-fgenesh-gene-0.6Cell division protein ftsZ
Pytar_ATCC12531maker-par_contig_254-snap-gene-0.11Gene of unknown function
Pytar_ATCC12531maker-par_contig_254-snap-gene-0.12Gene of unknown function

Sequence
2446 bases(100 bases per row)
GGCGTGCAGGTGCTCATCCCAGCGGCGCTTAACCGTCCGACCCACACGCTCTACAGCATCTGCATGTCGGTGCAGCCGACGCTCCAGGAGTGGACCGTGA
ACCGTCGGTATTCCCAGTTTCTCACGCTGCGCGCCGATATGATCACGACGCTGCTCGGCCGCCGCAGCGGCCCTGCCTGCCCGGCGTGCTCGTCGTTTGC
GCTCGCGCTGCGCAAGTATCCGTTCCCGCGTAAGGCGTGGATCCGCTCGAACCGCGTCGTGCGGAGCCGCGTTAAGGCGCTCGAGGGATTCCTGCAGCTG
CTCGTCGAGCGGCTCTTTAACGATCTGCCCAAGTGCTCCGTGTGTGGTGAAGGCCTCAAGAAGATGGTGCGGCCATTCTTGATTCGCGGTGCGCAGCCGC
TTGCCGACTCGACGCTGGGGAAGATTCATCACTCGCTGTCGCTGCAGTCGTACGCCGTTATCAAGCACCCCCCGCGCCACATTGACACGTTCGACGACGA
TTATGATGACAAGATGATGTCCAAGCAGAAGGCGGCGCCCGGATACAACAACAGCGACATGTCGTACGCGACGACCATGCGTATTACGGGATCCGACCCA
GCGATGCACGACGACGACGATTCCCACACGCACCACGAAAGCGTCGAGTTCCCGAATTCGACGCGCAGCGAAGAGTCGTACGGCGAGCAGTTTGACGAGC
CGCGGTGTACCGACACGCCCGTGGCGCTGGAAGAGGCACTGAAGCAGGTCGTGATGAACGACAAGCGCAAGAACACTCTGGAAGAGGTTGCGTTCCGCCT
GACGACCATGTGGGATGCCTACTCGCTCGAAGAGACCCTCGCCGCCGATGCGCAGCTGCGCATGCGGCTCACGCAGACGCTGCAGGAAGAAGACTGCTCG
GACGACGGCTCGAGCGATGCCCATGCCAAGGACTTGAGGAACGACGACAAGCGCGACGACGTCTTTGACGAAGACGACGACGTGGTCCACATGCTCGAGG
AAGAGAACAACGCGTCGTTTGCCTTGCTGCAAGACGACTTGGAGTTTGTATTGGATGACCCCGAGCTGGACGAGGACGCGCGCGAGACGCTCGCCATTGA
CACTGTGTCGTACGCCTTTTAAAACCACGATGCGGAGATGAAGCAGTAGCACCCCCTTATAGAGACAGCCCCCATAGAGAAAACCCACACACCACCACCA
CGTCTCCGAACTCTGACGAGAAAGATTAGGAGCGTACGACTCGATTCGCACCGCCAAATGAATCTACTACAACGGTAGTCATACCTATCGGATTCCTTTT
ACCTCAGTCTGTGACTTCGTAGTACTACTTTTTCTCAAAGTCGGCAATGCCCGTGGCCACGACCGACACGCGCAGCTTGCCCTTGAGCGACTCGTCGAAC
GTCGAGCCAAAAATGATGTTGGCGTGCGGATCCTGCAGCTCCTCGGTCACGCGCGCAGCGGCCTCGTCCACTTCAAACAGCGTGAGGTCTGAGCCGCCCG
TGATGTTGACCAGCATGCCCTTGGCGTCGCGGATGGAAATGTTGCCCAAGAGCGGGTTCGCGAGCGCGGCCTCGGCGGCCTCCAACGCGCGGTTCTCTCC
CTCGGCCTCGCCGCTGCCCATCATGGCGTTCCCCATGCCCGACATGACGGACTGCACATCGGCAAAGTCCAGGTTGATGAGCCCGGGCATGACCATGAGA
TCCGAGATATTCTTGACGCCATCCAGCAAGACATCGTCGGCCATGCTGTAATTTCAGTACAAACAGACATTTCGTGAGCCATTGTGGAGACAGATACACT
GAGATAAAGTAGCGTGTCGTACCGGAACGCGTCCATGAGCGACGTGCGGTCGTTCGACATGTTGAAGAGGTTTTGGTTCGGGATCACGATCATCGTGTCG
ACGCTTTGGCGGAGCTCTGCGAGTCCGTGCTCGGCCAACTTGGAGCGGTTGTTGCCTTCGAAGCGGAAGGGCTTGGTGACCACGGCGACCGTGAGGATGC
CGGCTTCGAGCGCGGCCTGCGCGATCACGGGAGCCGCCCCCGTGCCCGTGCCGCCGCCCATGCCGGCCGTCACAAACATCTACCAGTTTACAGTCTCCCC
TTAGATCCGATCAAGAGATCCTTAGCATGAGGTGAGACGACAACGTACCATGTTGGCGCCCTGCACTTTTTCCATGATCTCGTCGATCGCGGCCTCGGCG
GCCTCGCGGCCGACCTCCGGGTTGGCGCCGCACCCCAGTCCACCCGTGAGTTCCGGTCCCATTTGCACGCGGTTGTCGGTCAGCGTCGTGCGCAAGTGCT
GCGCGTCCGTGTTGCACACGAGGAACTCGACGCCCTGGAGTCCGCGCGCAATCATGTTGTTGACGGCGTTGCCGCCCGCGCCGCCGACGCCGACGACCAC
GATTTTCGGGGCAAACGACGAGAGATCGGGCGTGTGGTGGTACTGC