Description :
From Genome Similarity Track
Location :
contig_124:59138- 66449
Transcript NameFunction/comments
g11463.t1hypothetical protein
g11464.t1hypothetical protein PHYSODRAFT_564308
g11465.t1hypothetical protein PHYSODRAFT_318381
g11466.t1serine hydroxymethyltransferase, mitochondrial precursor

Sequence
7311 bases(100 bases per row)
AGCTTACGAGAAATTCTTTAAACTGGTGAAGATGGTATGCCCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACACG
CCAGATTGCGCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACAGAAGCGGTGAAGGTGGAC
CCATCGGCTTTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAGC
CGAATGTTGAATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGGA
CGTGGACGAGATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCCC
AAGGAAGTACTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTATG
CTTTGGACGGGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGA
TGTAAAGCTGCTAGGAAATGTTGAGAAGTTCTTCCTTGATTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTCG
AGAATCGCATCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACAT
TTTGGCGATCGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGTT
GATCCTCGTGTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAGC
GAAGAGACTGTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACAT
TGAGGGTGACAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTGC
TATCAAGAGCTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGGGCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAGGCTT
ACCGTCAAAATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGCACGA
GGCCGAAGAACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTGGGCT
GGGAAGCATTCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTTTGTG
ACCAAGTGCGCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAATAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGCTAGA
GGCGTTTGCTCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGAGAGG
GCGGGGTCCTCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTGCTTC
ACAAGTCCATCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGCAGAT
CACGGCGCACGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTCGGAG
AAACGCCACGCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGGCCTATAGAATGGCAGCTTCCTGAGGGTTGAGCGAGAAG
GTTGTTCTATCCAGGATTTTGCGAGGCCAGTATGAAAGTGGCTCAATTTATAATGAAGATTACAGAAGTCGTTGCGCATTACAGCGGCTAAATTTTAGCT
TGCTGGGGTCGATGCAACGAGCGGTATTGGAAAGTTTCTTTGATGCTAGTGCTAAGCGCGAAGGCTGTTGGAGCTGCTCTGTTGCGAGAGCGGGAAATCG
CTGTAGTGCTTAGGCTTGCGCACCGCAGGGTCGGGCAGTGCGCTGCCTTTTTCCTGTTTGGCGCGCCATAGATCCTGCTGGTCCTTGAGACCACGCACCC
ACCGCTTCATGTCGCCTTTGCTCTCGGCGCGCAGGAAGAAGCTGCGCTCGGGGGTCTTGACGACGAAGCTGTACACGCCGTGGTCGCCGTTCTCGAACCG
CCGGATAGACTCGATGCCAAGGAGGTCGATGACCTTAGATGCTTCTTGCGAGCTTTCGTGCTGGTAGTACTTGAGCCTCATGCCCTCGAGGGCGAAGAAG
CGCTTGTTCCATTGCGGGGTCAACAGCCGCTCCTTGGCCTTCATCTTGAACAGGTAGCCGCTGATGGGAACGGGGCCGCGTTCAGCTGGGGTCTTCATGT
TCGCCGTGACTTCGTCGTCGACTGGGCAGATGCCGCTTACACAGCGGGTGGCGAAGTGAAAAGTGCTCGGGGGTCAGCGTGCAGGCTATTGCTGGCAGCA
AATTGCTGGCTTGGGCATCTTGTCGCGATGTTGAAGTTCTTTTTTTAGAATCGATTGTTTTAGAATCGCTAACACAAGTTCTATTTTTAGAATGTACACA
AGCTTGACATAATTTATGTGGCACTTGTGTTGAGATACGCCCGTCGTGGATGCCGCTGACGTCGATGCCAGCGTTGCTGCATATCCTGGCACTGCTCGCT
ACTCTGCTGTGTCTGGCCTCCTCCCCGGTCATGGCATCAACTGCTCAACAGCTGACGCTGCGCGTGGAATTGCAGCAGCAGCTCGGACTGCCGGAGACGC
TGCAGGCTCCGATGACCCTCAGGCTGACAAACGCTCCGGCCTCATTGACAGAGCTGCAAAGTGAGCTCCGTCAGCGGTTAACAGAACGTCTTATGGAGAA
TAAAAACAGCGAGCGAGTAGCTGCTGAATTGGAGATGGCGATCGAAGTATATGACCAGAAGATGCAGCAGTTTGTGCCTTCAAAGAGCTCCAACAGCTCG
GACGTCGCTCGAGACTGAGCGTCACGTTCACCAACGCAGATGACCTGTTCCCGGACCATACGTGCCTAGCACTGCCGTCAAGGATCTTTGGGTTTGATGC
AGCGGAAGGCGGCAAGTTTGCGATCGACGGGAGGGTGGTGCATATTGAGGAGGTGGGCAACTCCGGCAAGGGCACGGGATTGACGACGTGGGACGGATCC
GTGGTGCTGGCGAAGTATATCGAGCACCAACGACGTGATGATGTCGCTGGGAGCCGAATTGTGGAGCTGGGCGCCGGGACAGGACTAGTAGGCATCTCTG
CTGCGCTGCTCGGAGCACAACAAGTGATCCTGACGGACCTCGACTACGTCGTGGACAACCTCGCCAAGAACGTGGCTGAGACGATGAAACTTGCAGCTAG
TGAAGGCAAACCCGTAGAGAGCGACGTGTCAACGCAAGTGCTCAACTGGTTCGACCCGCCAACGGATTTGGGAGACATCGACTTTTTGCTGGCGTCGGAC
GTCGTGTGGGTCGAGGAGCTCATTCCGCCGCTCGTCGCGACGTTCGACGTGTTGCTGCGCCATTCCGCTGTGCAGACGCGAATCCTCATGTCATACCAGA
AGCGCAGCATCATGTCGGACCGACTGCTCTTCAGCGAGCTCGAGCGTCACAGCCTCGTCAAAACCCGCGTTCCAGCCGCAGCCTTACATCCGGAGTTTTC
CACCGACCGGATCGACGTGTGGGAGATTGAGTGGGGCGCAGCAGAGCGAAGCAACTAGAACGCCGTGGTCGAATAGAGGAGTGAACGTGCGGTGCCCAAA
TAACAAAGCCGATGCTGCTTCAACTGGAGGCAACGTAATCTGCATAGCGACGCTGGGCATCCTATCAATGTCGACTGACAAGCAGCGCGTGGTCAAGTTC
AAATCCTACGATAGCACGAGCCCTTGAAAATGTATTTACTTGGGAAATTAATTCTCCACATCTACATTCTCACTTCGTTCGACCTTGCACATTACATATT
ACTGTGAGACATAAACATAGTTAAAGGCCAAAGTTTTCGTGGTGTCTGCTGCAACCGATCTTGGCGCCCGTCGGACGCTGTGCGAGCCATTCGCGTACTT
GCCCCGTTCCAGCCACAAGATGCTCGGCTTCCTGCGTGCTCCCGCCCGTCGCGCGGCGCTCCTGGCGCGCCGCCACTCCTCCTCCGAGAGCCTGCAGTGG
GCCGCCGCCATGAACAAGCCGCTGGCCGAGTCGGACCCGGAGCTGTTCAACATCATCGAGCTCGAGAAGCAGCGCCAGCGCGACTGCATCAGCCTCATCG
CGTCCGAGAACTGCACGTCCGTGGCGGTGCTGGACGCGCTGGGCTCCGTCATGTCTAACAAGTACTCGGAGGGCTACCCGGGCGCGCGCTACTACGGCGG
CAACCAGATCATCGACCAGGCTGAGGAGCTCTGCCGCGCGCGCGCCCTCGAGGCCTTCAACCTCGACCCGGAGCAGTGGGGAGTCAACGTGCAGTCGCTG
TCTGGCTCACCCGCCAACTTCCAGGTGTACACGGCGCTGCTGGCGCCGCACGACCGCATCATGGCGCTGGACCTGCCCCACGGCGGCCACCTGTCGCACG
GCTACCAACTCGGCCGCAAGAAGATCTCGGCTACGTCTATCTTCTTCGAGAGCATGCCCTACCGCCTGGACGAGAGCACGGGCCTTATTGACTACGACGG
ACTCGAGAAGACCGCCGGCCTGTTCCGTCCCAAGCTCATTGTGGCCGGTACCAGCGCGTACTCGCGCCACATTGACTACGCGCGGATGCGCGAGATCTGT
GACCAGCAGGACGCCGTGATGCTCGCTGACATGGCTCACATCAGTGGCTTGGTGGCTGCTGGCGTCGTGCCCTCGCCGTTTGAGTACGCGGATGTGGTGA
CCACCACCACGCACAAGTCGCTGCGTGGACCTCGTGGAGCCATGATCTTCTACCGCAAGGGCGTGCACCACGTGGACAAGAAGAGCGGCAAAGAGGTTTT
GTACGACCTTCAGCAGAAGATCGACTTTGCCGTGTTCCCCGGACTCCAGGGCGGACCCCACAACCACACGATCGCAGCGCTGAGCACGGCGCTGCTGCAG
GCGCAGAGCCCGGAGTTCAAGGCGTACCAGTCGCAGGTGATCGCCAACTCCCGGGCCATGGTGGGTGAGCTGATGAAGCGCGGCTACGAGGTGGTCTCGA
ACGGCACGGACAACCACCTGGCCCTGGTGGATGTGAAGAAGTCGCGTGGCGTGGATGGCGCCCGCGTTGAGTTTGTGCTCGAGAGCGCCAACATGGTGGT
GAACAAGAACACAGTGCCCGGCGACAAGAGCGCCTTTGTGCCCGGTGGCATTCGCCTTGGTGCCCCTGCGCTGACAACGCGTGGCTGCACGGAGGAGGAC
TTCGAACAGGTGGCCGCCTTCATTGACAGCGGTGTGAAGCTCACGGCTGAGCTGAACGAGCGTGCCCGTGGACAAGGAGTGAAGAAGGTGAAGGACTTTA
AGGCGTTTGTCGCTGATGACGTCGAGGCGAAAGATAGGGTGGATGCACTGAAGGCCGACGTGACGGCGTTTGTGCGCCAGTTCCCGACGATCGGCTTCAG
CGAAGAGGGCATGAAGTACAAGGACTAAAGTGTCCGACAGGCAAAGAAGAGGTTTCGTTGCTGAGTGTATGAATGGCATGACGACCTAGTCTATCCGATA
CTGGCTCGGTCCGTCTCCTCTTTGCCCCGAGACTCTCTGCAAGGATGACCAAGAGGGCGATACAAGAAGACGTGGCTGCTTCTGCTCCCTGACATTGCCA
TGGAAGGCAGCATGATGGTCTCCTCTTGACCCGTTCTGACGGCACGGAGCTCGCGGCGGCGTGAAGACAGATTGAAATGGAAGTTACGACATTGAACAAT
GAACGACCTGCCTGCCTGTAGTAGACTCAGCTCACACTGATACTTTGCTGCCTCAGTGAGACCCGCTGCACCCATATGAGAGGAAGCACTGAGGGGTTCA
CTCTAATTGTTAGTGCTCCTTGGCTTGATTCATGCAGGAACTTGAGGAGCAAACATGTATGGTAACGGACGGAGTGTGCTGCGTTGCTTTTGACGCCAAG
TGTAGCCATTTCCGATAGCTCCCCTGCCAAACCCGATCTCGAGTGACGATCGTGTCGCAGGCACGCAAAAAATCTCACTGGACTGGCAGTTGACTTGCAG
CCAGTATGCCCGGGCTGATGCATGAGGAGCGCCAGGTGGCGGCGGCCGGAATTGCGTGCGGCTCCAAGCTAGGAGCACCGCTCCGAGCAGGCAGTGACAG
GCCCGCCATTTGGCGCGGTGTCGCCCACGACTGAGGAAAGTGCTCGATAGCGTGCGAGCGACCACAGCCCCCTTTAAGCCGTCCATCCCGATTTAGTCGG
TGCGTACGAAACAGAATTGTAGCGGCTAGCTCTTCAGCCGCACCTTTTATTATGGACCGGCACGTACCGTTCCTCTCGGATAAAGTTTCCATCCTGTCGT
AGGTGACAGATGGCATTCGACGTTCAGTATCGAAGGTTGTACAGTGGCATGACCGTATAAACTTAAGCGGCATTCTGACTAGCTACTGTCTCTTTTTTTC
CAGTATGCATTTTTGGGCTCTTTTGCATTTTTTGGGCACTGGTGAGACCCGATGATCTTCGCGCTCCGAGCAGCCATGCAAGTTCGCTAATGCATGCACC
CTGCAGCACTGCCTGCACTGGCAACAGCAACATTGGCAGCAGCATCATCGTGTTGTCGCGTCGAATTGCTGCCTTTCGAACCGATTCAGCGCTTCCCACG
CCAAATTTATT