Description :
From Genome Similarity Track
Location :
Scaffold_323:5913- 6971
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-snap-gene-0.7Novel protein.

Sequence
1058 bases(100 bases per row)
CTTACCGATGGTTTGACCTCGGATCCGTCTGCACGTCAACTCTCCACCGTGACGCTGCTGCAGAACCTCCAGAGCTCGTCGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCAACGACGGAACCGACGACGAATCAAACGTCGATCCATTCCAGTACGTGGACTTCCAGCAGCAGCAAACGCCACTGCGTCGCTTTGA
TAGCAACAACAGTGTTAATGCTGTGAGTCAGCGGCATGTGGTGCCGTTGGACTACGACAATGATCGTCCTGATGGCGTCGTGATTGAAGACCGCGTGTGG
CGCGCATTGAATACGCTGCGCACGAAGAAGATCTTGGTCGAGCACAGCGCGAAGGAGAAAGCCGAGCAGTACGCTCTCGCCAAGGGCGTCGCCGACGAAT
TCAGGCTCCAACTAAGCGAGCTCCACGTCGCGCTCCAGGACCAACACTCATTGTNNNNNNNNNNNNNNNNNNNNNNNATGCAACAGCTCGTCAATTGGAC
GCGCTCGCGAACAGCGCGCCGCTGCTCGTGCACATCAAGCAGGGCCAGGACGAGTCGAGNNNNNNNNNNGAGCTGCTGCTCATGCAGCGCGGGACGGCGA
TGACGGCCACCAGAAAGGACGACGACGCGTTCCTCGTGGCGCGCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGATCCAGCTC
CACGGCAAGGATCAGGTCGGGATCCTGAGCAAGATCAAGAACTTTCGCAAGAACATCAACATCATGGAATGGGAGCACACGCTGCTGGAGCTCCAGACCA
AGGACATGGAGGAGCGGTACACCGACATCCAGCTGCTGCGCGTGACCAAGGATCTCCAGGAGCTCTTCCACACTGGCGACACGACTCAGAAGCAGGCTCG
CGAGATCGCGCTCTTGGAGGCCAAGATGGGCCACGTCGGCACGCATCATGCAAGCACATTGCTGAAAATGGACCAGGCAGCGGCCAAGTTGCATGCTCAG
TTGCGCGACCGTGTGCATGAGAATCAGCGGTTCAGCGAGCAGGTCCAGCAGCTCCAGA