Description :
From Genome Similarity Track
Location :
contig_7:59121- 60679
Transcript NameFunction/comments
g1995.t1hypothetical protein

Sequence
1558 bases(100 bases per row)
CTAGCCTGGGGAGGTTCAACAATTTTGTGTTCACGTTCGAGTCGTCCAAAGCTGGCGTGTTTCTAGAAAAATGGCTGCTGGATGCAGAGCCACAACCGCG
GATTTGCTTCGGAACGACCCCCAACGACACTGACAATACGGATTCATCTGTGGATCTCCCAGTTGAGGTGCGCTTAAGTTGCGTTGCTGAAGAAACTTTG
CTGCTTGGAGGCGTCGTCAGATGCACCTCACAAGCGTGGAGCAGAGCGAGAGTCACTTTTTCGTGGCAAACATGGTTGACGAAATCCTGGATGGAGTGGG
ACCACCGGAAGCTGTGTCATTCAGTGAGCTGACACCTCGCACAGATGCCACCAAGTTTTACGAGCAAAACGGGTCCAACGAATTCTGCGATGCGTATTTC
AGCCCTGACCTCGTGCGTGCCTGCTATGCGCTTTATGAACGCGCTCAGGATATTCTACGATCTCTCTCACCGGTGCTAGCTCCAGCCATCGAAGAAGCGA
GTCCTAGGGAGGACAAAGTGGATAGTGAGGACACCGACGGTGTTGGAAATACCGTCGACGCGCCTCCTGTAGTTCCATCAGGACTGGGCAGCAACAACGA
GGGCCTTGATGCTGAAGCCCAGCAGGACGCAGCAAAGCCCCCGGCGCTTCCTGCTCACCTCGTTGAGGAATGGAATTGGCGTTTGGAAACTCTTCGCGAA
CTTTGTAAAATGGCCGACGAAGCTCAAAACGCGCAAATTGGTCGGTTAACTCGGCAGTTAAAAAGGGAAATCGAGGACGTTGAGGAAGAAGACGAGAATG
AAGAAGAGGACGAAGAGGATGATGCAGAAGATGACGAGGCGGACGACGACGATGAGGGCAGTGAACATGGGGAGGTTGTTTCTGAGAAAATCCAACGCTT
AAGCCCTCGGGAAGTGCGTACGATTGAGAGGCTTGCTCGACGTACAACACTGGAAGGCGAGATAAGTGCCTTGAAGCCGGATCTACAGGAGACATTTGAT
ATGATGCGCTACTCCGCCTACACAGCTCCTTATAGTACTCTACGCTTGCACGAACGACTACACGAGCGAATTGGGAGTTTATGCAGTGAAGCCCCAGTTA
TCTGCGAAATCGCGAAGATGACGAACGCCAACAATGCATTCGTTGCTCAAATAGCCAAGGTTGAAGGGGTGGGGAAACTACTCATGCGTGCTATTGACGA
AGCTGTTGGCGGCGACCAAGACCACCAGGCTCTCTTCGAGCAAGAACGACGCCGAATTCAGGATATGTGGCTAGGAGACAAGGCATCGTACTTGTCAACA
GGTCAGTGTATGGCAAAGCAGCTAGCTTCGGCGTCCCCACTCACAAGCACTGAAAGCACCGATATTCCAGCCACATCAAGCAGCCCCGCATCTGTTAACA
GCTCTGGGGTGGTCCTAGTGCAACTAGACCTGGATTTAGCTCCATGGTTTTCACTTGTGAAGGTGGAAAACAAAGGAACTGCCGCATCGGTAGACGGAGT
TCCTCCTAGAATTGAGCTGGCATGGCGCTTTTCCCCAGACTTAATCCAACACGCGAGT