Description :
From Genome Similarity Track
Location :
Scaffold_19:59121- 60236
Transcript NameFunction/comments
Phyta_totarag1126hypothetical protein PHYSODRAFT_285654

Sequence
1115 bases(100 bases per row)
GAGCAAGCGCTCGATGCACCTCGCGACcgcgacgagctggccgACCACGACCTGCAGCGGTTGTACGCGCGGTTCGACGCCTTGCGGCCGCGCGACGGCG
CGCCCGTCGCCATCCTCGAAGtggaagcgcagcgccagcgcctcgtgCGTACCTTCCTGTTCCTGCGCGCGTTCAACGCCGAGAGCGCGCGCGCCGGACG
ACCCACGTGGTTCAATTTGCCGCCACAGCAACAGGACGACCTGCGCCGCATGAACGGGCGACTGGGGGACCTGGCGGCCGTAGCGcaggacgagttcgag
ctgctcactCGGATCTGCGAGGAACCGCCGCCCGCTGTCCTGCAGCAACTACCTCGATTGCAACGGGAGGAGCGTCCGATGGGggacgagatgaaggcgg
cggctGAAGCGTTGGCGGGGCTGCCGATGTTCCGACCCACCAATCAGACGTTGTCGCCGACCTTGTCGCTCCCGTCATCACCCGTTCGGACGGTGGAAAA
GGGGGCGTCGGAACCGGagtccaagcagcagatggcGTCGGATTCCGATGAATTATTGTCGGAGGAGGATTCCGAATATGCTCCGACCAAGAAGAGTCGC
AAGCAGAGAGAGTCCGATATGGACTACACGCCACCGAAAGGAAAGGCCAAAGCCAAGGGCAAGATGACCTCCAAATGGTCCAAGCGAGACGAACACCGAC
TCATCTCGGCGTGGCATGAAGTGGTGATATCGCTCGCCAATAACGGGTACGCCGGGTCTTACGCCTCGCGGAACGAGGGACTCCGACTGAATTCCCTCAT
CCACCAGCGGTATGTCGAACTTTGCGGCGGCAGTGATTCGGCCCGCACGAACCAGTCGACCGGTGCGAAGAAACATGCCATGATGACGGCGTTCCGATCG
TTGCGTGGGGTGCTCCGCACGCTGGCGTCGCTGAGCGAACGTCCGAACTGGTTCGGCATGACGCCGGAGGAGCGGATGGAGTTGCAGAAGATGCACggac
accaccacgaacacgCTTGCTTGATTGAGAAAGAAACGTATCAGCGACTGGGCGAGATCGATCGGGCCCAGCGGGCGGTTTTAACCCCGACTGCCGATGC
TCTTCGTGCCCCGGT