Description :
From Genome Similarity Track
Location :
Scaffold_75:591- 1809
Sequence
1218 bases(100 bases per row)
gccatattctcctccgtaggaacatactcgatgtcgagcttccctctctcaaccagttccgctagcttccgacttttcttcgcatacctcttcacaccgt
cgaagttcccggcgtccgtgcacaccttgatggtgctttgattgtccacgtagagcttggcagtcctcttctcaaagccgagctccttgagcaactttct
agcccacagtacgtcctctgcgcacaaactcgctgccaccagctccgacttgcacgtgtcgtcggtcaccgacgcttgcatcttgctcttgaacccgacg
gcgtgtccgttcaacctcaacacgtaccctgacaccgaccttgacgtgtcgggacagttcgcatgatccgcatcgctaaatgcgctgatctgcaatccgt
cgttctccgagcttctgcacttgtacaccaacccaaatgtccttgtccctcgtaagtagcgcagcactctcttcgctgttgtgtagttctccttcgtata
gttgctcgcatacctacttaggctccgcaccgcgtttgcaatgtccgggcgagtgcatgtgaccaggtattgtagtgccccgatcagttcttgatacttg
atcttcttgtcgttcaccttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccttcacagtcttgatgtcctcaccacagccgataatcatcacgtcgtccacgtagaccgtcagc
atcacgagtctgccctcgatccacttgtagtacaggtccacgtcgtaattgcttctcttgaatcccatcttcttcaaatgtccatgcaaagtcagatann
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntt
caatccatacagccctttcagcaacatgcacaccctgtccgtatcatcgtcgaacatctcgggttgttcaatgtagatagtcgctccgtccatctcggaa
ttcaaaaatgcagtgtcg