Description :
From Genome Similarity Track
Location :
contig_2:590994- 593176
Sequence
2182 bases(100 bases per row)
GGACAGTTTTCGAAACAACCCAGCCTATGATCTCCTGAAGGAATATAAGGACACCGTATTCCGACCGGAGCTACCTGAAGGTTTACCAGAAAGAGAGAGA
TCGAACATCGGATCGATGTGAAAGATCCCAATCTCGCCATGTATCGTCAACAGTGGCGACAGTCGCCGGAGCAGCAACGAGAAATCGTGAAATGGGTCGT
GGAGATGGTTTCGAAGAAACTCATCCGTCCCAGCATAAGTCCACATGCCGCTCCGACATTTTGTGTCCGAAAACCCGTTGGATGGCGTATCGTCCATGAT
TATCGATACCTGAACACCAACACTATTCGTCAAAGCATTCCCATGACTCGAAAGGAAGATATCCTGGACGTCATGGCTGGAGCTTACTACTTTTCCACCA
TGGACTTGATGTCGGCGTATTATCAAGTTCGTCTGCGGGAAGATGATATCAAGTACACAGCTTTTCAAGCTCCGAATGGACTCTGGGAATATCTCGTGTT
GCCAATGGGTGTATGCAATGCTCCTGCACGATGCACCGCTTGACATCCAAACTGTTTCGAGGCTTGGAAGAAACGAGATCTTTTTACGACGACATTTACA
TCTTCACCAAGTCTCGTGACGTCCAAGAGCATCTGCAAGCTCTACGGAAAACGCTGGATATCTTGAGGGACAATAAGTTATACGTGAAACTGGCCAAGTG
TGTCTTCTGTGCGGAGGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAATGGTGTTCGCATGGATCCCGACAAGGTCCAAACCATCAAGAACTGGCCG
GTGCCTCGGACACAAGAAGAGCTTCACAGCTTTCTGGGCCTAACAGGCTACGTACAACGTTTCTGTCCGGAATATGCTCGTTGACAGCCACAATGTTTGC
TTTGTTGAAGAAGAAGAACAGGCGTAACTCCAAGATCCGCTTCAGCGACGAGCAGCTGAAGAACTTCAAGGAGTTGAAGCGACGCTTGTGTAATCCACCA
GTACTGCGCTTGCCGGACTTCAGCAAACCAATGCACCTGCGTACCGATGCAAGTAAGTTCGCGGTTGGTGGTGTACTATTCCAAGTCATCGACGGTGTCG
AGCAACCCATTGCCTACCAGTCGAAAGATGAAACCAGCGGAGTTAAACTACCCAACGCAGCAACAAGAACTTCTAGCGATTGTGCACGCGCTGGCAGCTT
TCCGAATTTACTGCTTGGATAAACCTCCAGTTATCGAAACTGATCACAAGAGTCTGGAAGGGATTTTCACTCAGAAGATGGCAAATCGTCGGTTGGCACG
GTGGTACGACATTACCAACCACAATTCTCGTATCTGCCTGGAGCGCAAAACGGAATTGCTGACGCCCTGAGTCGACGTCCAGATTTGCAGCCGGAGACGA
AGTACTTTCATGACTTAAGTGTTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCGATCACAACGGACAGCGAGCTAATCCATCGATTAAA
ACCGCGTACACCAAAGATCGAGAAGCTCAAGCGATATTCGATGCTATCCGAAGGCGACGTGAAAGTACGAGCAAGCGTGTCGACCGTCAGCACCGGAAGA
AGTATCGGTGTTACCATGAAGATCGTGGACTGCTGTGTATCAGACAACCAGCGATGACACACCTCGTGTAGTCGTACCAAACTCGGTCAAGGTTCGTCAA
CAGATCATCAGCGAATGCCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATATCTCACACTGTCACGTCACTGGTATTGGACCAAGATGA
TCAAATCCATCCAGAAGTTCATCGCTGACTGTGAGCCGTGTCGAAGAAATAAACCTCGGCTGACCAAGCCACCCGGACTGTTGGAACCGCTTAGTATTCC
TGAGGAGAGATGGCGATCAATCTCCATGGATTTCATAACAGACCTGCCCCGTACTGCACGGAAAGTGGATTCAATTTGGGTTGTCGTGGATCGCTTGACG
AAGAGATGTCATTTTGTGCCAACAACCAAGACGGTAACTGCTGAAGGTGTTGCTCGTTTGTTCATGGAGAACATCTGGAAGCTTCACGGAATGTCTACAA
GCATAATCTCTGATCGAGACCGTAATTTGTGTCTTCTTTCTGGCAATACGTCTTCAAATCAATTGGAACGAGCCTGAAGATG