Description :
From Genome Similarity Track
Location :
Scaffold_1332:5909- 9106
Transcript NameFunction/comments
Phypl_g13133hypothetical protein

Sequence
3197 bases(100 bases per row)
CCCAAGTAGGCTCGCCATAACCCACCCATTTCACCTTGAACTCGCGCACCGACCTCTCGGTACTCGTTGTGAGCGGTGTCCGGTCATCGAGAATCGTCTC
GACTTCATATTCACCAGTAAGCTGGTCTGGTACCCAGCTGGCTTCTGGTAGTAGTTCTTCATCAAAGCCAAGTCGTGAGTCTTCGGCTACATCGGGAGCC
AGGCGAGTTGTCGGTCTGCTACCGAATTCGCTCACTGGCTTTAGACGGGAGACATGAACTACAGGGTAGAACCTGTAACCGCTTTTAtctggcagctcga
gctcgaatGCGTACTCCTCGATTCTCTTCTTGATCCGAAAGGGGCCATGCCACCGATGAGCTAACTTCTTGGTAAGCCCAGGTTTGACCCGTTCCATGTA
CAACCAAGCACGACTGCCCGGTTCAAACAGAGACTTCGGCGCTTCGTTTGGATGATCAAGACGTGCTTCTGAGTTATCGGGGCCAAGTCCCGACGACTCC
CGATGGTTCGTACGCGGGATTGTAGCTCGCTCTTTCCGGCTTAAAGCTTCGTTGTTttcacgagctcgtcgatcCTTCTCTGTCGCTTGATATTCCATGG
CCATCTTTAACGCAACCTCATGCTGCCGGTTGACTTCACGTCGCCACGCCAGGGCGTCCGACTGCTTGCCCGTACCCCGGCGAATAGACGACGACATAGC
CTTGAGCGTGGATTGAGCGTCCCAGCCATGGACCAAGTAAAATGGTGTCTCCTTCCTTGTCGTGTCTTGCGAATTGTTGATTGCGAAGACTAGTCGTTCA
ACGATTTCACCCCagtcctgctgcagcgggtcTTCGGCATAAACTCTCACCGACTTCGTCACCGTCTTCACCGATCTCTCTTGCTGCCCGTTTGCTTGCG
GCCGATAACTCAAAGTTGCTCTCGACCGAGACTGCATCACCTCTGCAAAAGCCTGAAACACCTCGCTCATAAAACGTGGATCACGATCATGCCTGATCAG
AGATGGTGCTCCAAATCTTCGGTATACACATTCTTCAAAGGCCTGTGCCACCTTGAGCACGGTCATGTCCGACATAGCCTTGGCGATCGCAAATCCAGTG
AATGAACACTGAAACAGGAGCAGTGCCGTGTTGCCTCGCCGAGATTTCGGCAGAGGTATCACGAAGTCCACTGACACTATCTGGAACGGACGTTCGGCCA
GCACATTGCCTGGTGAGTATCCACGCAGATGAGGACGGCTCTTGCTTGAGCTACAGTCATGACAGGACTTCACATGCTTCTCGACGTCTACACAGAGTCC
CAGCCAATAGTAATCTCGCCTGACTCGTTGATAGGTTCTCACCACACCTTGGTGAGCACCTTCTAGTGAGTCGTGGCAATTCTGCAAAACTTCTTGAATC
ATCGTGGTAGGTATCACTAGACGTAGCTTGATCTCGTCTTGCTGGTTCGCTGTGTCCCGACGACTCATTCCAATGTAATGGAGCAAGCCGTCGTCGGTTA
GCACGAACTTATCCGCCAATTTCCATGCGTCTCGTGCAGCCTTGTATCCGAGTTTCTCGACTTCTCCACAGAGGACTGCTTTAAGATTCGACCATCTcag
ttcttcgtcttgagctgtCGCGAtgcgtcgacgtcgttcttcttgtATAACCACTgggtcgacgtcttcagcgttCGGATCCCTCGCTGATGTTTGCGGT
GCCCCTGTCTGTGAGTTTCTCGAGTCGTCCGGAGGCTGTTGGTAGCCTAGGGAGTCTTCGGGACTCTCAGCGCGAGTGCTCCCTTCTGGTGTTGAGTCGT
TCACTCGATGCTCCAAGGACTCATCGGCAAACCTGACTTGTTTtttcttggtcttggtctGCGAACGAGTCATCGCCATAATCACATAGGGCTCTCTACG
GATGAAATCTGCAAACGTCTTGGGGAAGGATGAGGTGGAGGCTTCTATAGTGTGAATAGAGCCTCCTGAAACAGGCGCTGGTGCCTCAGTGTCTCCCTGT
GTCTTCTCGTAGATCACTTCTTGGATCCGATTGAGTTCACTGAGTTCAGCTTTTCGGTCTCCGCTCAGAATTACTCTTGATGTCTTCGATTCCAATGCCT
CCGTGGCTAGCGAGTCGGCAGCCGCGTTGTATTCTCGGACCACATGCAGATATCTCACTGACCGTAGTCGTCCCGCGAATTCCTTGTGGCGGTTTAACTG
AGTCATCAGCGACTCCTTCCGACACGCTATCACCCCTAGTGATTGCTGTATCGCGAGCCTCGAATCACCCACGATCACCAGGTCTTCTGCACCATGCTCC
AAAGCTGCGAGGACTCCATTGTTCATTTCAGAGTACTCGGCGACATTGACCGTGGTCGTCTCGAGGTAAGCAGTTGCTGCGATCACTATCTGCCATTCCG
GAAGTCGCCACAGAATCCATGAGCAGCTTCCATAGCCACCGTACTTTTCAGTCTTCGCCGACCCATCGAAGGAAACGACGAAGCCAGCATAAGTTCTCGG
TAGCTGGGCGTAGAGCAGATGTGGGTCCATGCGAACTGTCGGAGATCCTTTGTTAGGCGGTGCGACCAAAGCCAGGGAGTCATCGAGGTCTATAAAGCTG
GTCACCGTTGACTGTAATAGCTGCACGAAGGTGCAGTCGTTTTCTTTGACCCGTTAGACCTTCATATGCCACGGTGACAGCAGTGCAGCGAACTGGACAG
CTCTCCCGAAGAGTGACTTGGACTTGCTGATCCATTCGAGAGTAGAAAAGCGAGTGTAAATTCGCAAAGTCTTGCCCACCAGCTGCGTATAGCAGGTTTT
CAGGACTAGAAGTAGTGCTAGTACCTCTTTCTCAGCAGGATGGTAGTCCATCTCAGCGTCGTTGAGGACCCGCCCACTGAACCGAACTGGGTGAAGTTTG
TCATCGTGCATCTGGAGCAAGGTTGAGCTTAATGCCCACTCATTGGCAAACAGCATGATGTGGACGTCCTTGGGCTGGTCGAAGTGCCGAAGAATCGGTG
CGTCCGCAACTTTATTTTGTAAGGCTGCGAAACTTCGACGTGCGGCACACAGGTTGGGTTCTGTTGAGAAGTCCACATCATTGAGCTGGTAGAGCGCAGC
ACCGTATACTGCAAAGTCTTGAATGAACCTGCTGTAGTAGTTTAGTGCTCCAAGAAAAGATTGCATCCCTTTCTTCGTTTTGGGGAACGAGAGTTTG