Description :
From Genome Similarity Track
Location :
Scaffold_397:590720- 592366
Transcript NameFunction/comments
Aphin_H310_09911conserved unknown protein

Sequence
1646 bases(100 bases per row)
CCATTGCGGCCAGCCCAACGAGCGCTTCTCGTCGACTTTCTATATAGGGAGGTCTTTGGGTTCATGGACATCAAGGAGAGCGAAGGCCCACACAACCAGC
AACGTGTGGTCGACTTCTTCAAGTCCTTCGTCGAAATGGAAAAGCTGGTATCCATCGTGACCTCGTCCCGCCCATCCCAACGACTTGCGTAGGTGATCTA
CGGTCTCGTACTTTGTGTCGACAGCTTCCTTTACGTGTTCACGTACTTGCCACTGCGCATCCTCCTCGCACTGGGGTCGGGGGTCGTGTCGGTGTTCTGC
ACACGAATCTTTCGCCGATCCCACGTCCACGACGTTCTCACAGCAGTCATCATGGTCCTGAGTACCGCCGTCCTCATGCAGGTCGACATGTCTCGGGTGT
ACCACCTCATTCGGGGGCAAGCGCTGATCAAGCTGTACGTGCTCTTCACCATGCTCGAGGTACGTGCTCGAGCCGCTTCACGGAATCGCACGCCCACACG
ATGTTGTGTAAGGCAGATCTTCGACAAGCTCTTCAGCTCCCTCGGCCAAGACGTCCTCGATGCCATGTACTTTACCGTGCGGTACCAACCGCGGCGCGTC
GGCCGCATGATGTTTGACTTTGCCGTGTGCAGCATCTACGTCGATATCCTTTTTGCGTGTGTATATATTCATGTTTCCGTTGAATTCCGTTCGACCATCG
CATCCGTCCTCCTTGACCATGCCTGCACTGCTCCATTCGCTCCTCCTGTTCGGGCAAGTCGTCACAATCAACGTCGCGATCCACTCGAGCAGCTCGTCGC
TCATGACGCTCCTCATCTCCAACAATTTTGCCGAGCTCAAGGCATGTCTGCCAATTCCTCGGGCTATAGACTGACGTGGATGGATGCGGTGTTGTAGAGC
AGCGTGTTCAAGAAATTTGAAGAGCAAAACCTTTTCCAAGTCGCTTGCAGCGGTACACATCCCCGAAAATTGCGTCCTCGACGGGATCCTGGCTTGACGC
GGGTCCTGCGTTGGTAGATATCGTCGAACGGTTCAAGCTCATGCTGATCATCGGGCTCATCCTGGTGCAGTTTGACGGGAAGGACGTCGCCGACGGTACC
GTACGTCCGACTGACGTTGCTGGTTGGCGTTGCTGCATGGACCGATCGTAGCTTATGGTGCTGGCGGCCGAAATGCTCATTGACTGGATTAAGCACGCGT
TCATTAGCAAGTTCAACCAGATTCCGCCTACAGTCTACTCCAAGTTCCTCACGGTCCTGTGCCGCGATGTATCTGGCTACCGCAGCGACACCGTACGCTT
CGCACTCTCCGATCTGTCGTTGGTTGTGTTGAGCGCGGTCGGCCTGGTGACGCAAGTCTTCTAGACCTTTCTCGACCATTCGCAGTTTGTGTCGAGACGT
CTCGGGCTCATTTCGCTCCCACTTGCGTGCGTTGTCCTGCGCATGCTATGCAAGGCCTTGCGCGACTTTGACGTGTGGAATCAACTGCACACGCCGTCGG
GAGTGGTCATCGCAGTCTTGGGGTTTGCGACGCTCTCCGCATTCAAGGTGCGTCGCCGCGGAGGATGCCATGTTTCAACGGCCGACATGTCGACAGGTGT
TGTTGAGTCTGTGGCTCATGGTTCATGCGAGCACGTCCGGTCGGTT