Description :
From Genome Similarity Track
Location :
Scaffold_4:590636- 591922
Transcript NameFunction/comments
Physo_128276reverse transcriptase

Sequence
1286 bases(100 bases per row)
TGCATCAAGGCGCATCCGATCGCGAAGTCGCTCGCGTCGCACACGACATGGAAGGGCTTCGAGTGGTCTGGAAGCATGAGCACGGGCGCGGTGGACAAGC
TCGATTTCACCGCGTCGAAGACAGCTTGGTGATCGGGACGCCACGACCACATGGCGTCTGCCTTGAGTAGTTGAGATAGCGGGCGGATCGTCGAAGCGAA
GTTCTTCGAGTAATGGTGAAGATACGTGGCGAGCCCCAGCCACTGCCGGAGCTGCTTCTGGTCCTGCGGCGTCGGCCACGCGCAGATGGCCTCGATCTTC
TCGGGGTCGGCGCGGACACCGTCCTTGCTGACGTAGCTCTCGAGCACAGGGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGTTGGCGTACAGCTTGT
TCTCCTTCATCACCTCGAACACCTTGCGCAGGTGTTGTAGGTGGACCTCAACGTCCGTCATGCCGTCCTCGGCACGACTGTGAATGAAGATGTCGTCGAA
GTAGCTGGGCGCGAAGTCTCGGTACGGCCGAAGCAAGTTGGACACCATCCGGTTGAAGGTGGTGGGGGCGTTCTTGAGCCCCTGCGGCATTACGAGCCAT
TCCCACAACATCCCGCTGGGCGTGCTGACCGCTGTCAGCGGCACATCGTCTTCGCGCATCAGGATCTGATAGAAGCCATCCATCAGATCAATGGCACTGT
ACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGGCCTTCCTCGGGATCGGCGTTTGCGCCGGTATGGTAGCCTCGTTGAGCTTGTTGAAGGCGTGGAC
GATTCTCCAGCCGCCGGTTGCTTTCTTCACGCAGAAGGTCGGACTAGAGTGCGGCGAGAGACTCTCGCGAACGTGGACGGCTTGCCAGCGACTCTCGAAG
AAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCGTCACGCAGTACTTCGCACCGGGCACGATGTCAATCTCGTGCCGAACCCCGT
GGTCGGGTGGAAGAACGGCTGGAACCTTGTCCGGGAAAATCTCCATGAACTCGCGCACGAGCGGAGCGACTGGGTTGCCGGCCGCTTCGAGCGCCGGCAA
CGACTGAGCTGCGTAGCGGGCTTGACGGGCGTTCTTCGGCTCGGCTCCTTTTGGGCGCGTCCTGGCGTTGGAAGCTGGGTCCGACGCACTGGTTGCGACG
ACCGCAACTGACTCGGCGTCCTCGGCGACGATCATGCACACCTGCTCGATCTCGCCCTTCTTCAGGTCGCGGAGGAAGTGTTTCCA