Description :
From Genome Similarity Track
Location :
scaffold_37:59059- 66047
Transcript NameFunction/comments
Pl_111497phospholipase D; Pi-TM-PLD
Pl_111498tubulin-specific chaperone D, putative

Sequence
6988 bases(100 bases per row)
CTACCGCGCTGGTTCGTCTTGGCCATGGTCTTCAGCGTCTTGTGCTCGCTCGCGTGGCTGTCGCTGCTCGTTCTGGGTCCGCACTTGAATCTGCACGTGG
ACGCCACTTTCTACCTCTACGCGGGCGTGCTCAACTCGCTGTTCGGCAGTTTCCTGTCGGCCAGTGGCTACTGTTGCCAAAAGTACGCGCACATCCGCGT
GGCGCGCAACTCGGCGCTTGGCACAGCCACAATGCAGTCGGCATTCCTGGCCGGACTCTTCCTCTTGGCTGTAGGCACCATCTCAGCCGTCATTAACCTC
GGCATCCTCGGACAAGCCGTGCAGGCGCCCTTCGCGGCACTCACACTCATCTACAGTGCGCTGCTGGGTCGCTTCGTACTTCACGAGAGCTTCGGCGTCT
ACGATCTGCTCTCCAGTGCACTCATCGTTATGGGAGTTGGTGTCGACGTCTACGCCGCGCAACTCGCGAACGTGCCTCAGAAACACTATACACTCAAGTC
ACTTGGAAGACTGTTCATGAGGGAATCGGTCTTCCCGCTGGGGTACACCGTCATGGCACTTACATACGCCATGCTGCTGTTGCGACGGGTACATACAGAC
AAGCTACAGCGCCACCCGATCGGACTACTGGCTTTTAGTTCATGTGCTGGAGTCATGGCAGGATTTACGTCTCTCGCTACCAAATCAGTAGTCGAAGTGA
CTAAGTCGGCACTGAATCACCAAGACTGGTTCGTGTTCCTGAACCCGTTCTTCGTTTTGATGGTAATTGCCATTCCCTGCGCGCTGGTACCGCAGCTTTT
CTTCTTGAACAAGGGACTCGAGTTTTTCGGCACGTTAAAATTCATCCCGTTGTACCAGGCATTCATCATCATCGGCAATATGGGTTGTGGTATGATTTTC
TATGACGAGATGGCTAGCTATAGCTCAGATGCACTCGTGTACTTCTTGGGCGGCATCATGATCACGATTTGTGGCGTGTGCGTTTTGCTCGTAAAGGTGG
ACTCCGAGAACAGTAACGGTGATGGTAGACGATCAAACGCGGTAAAGGCAGTAGATCGCCCGATGGATGAACTACTGGACCAGAAAAGCAAGGATAAGGA
AAGATTCGAGACAGACTTTACGTTTAAGCAGATGAAGTGGGCCGAGGATAGCAATGACTCAAAGCCTAACGAGCTGCGCGTATGCCGCGACTTTCGTGAG
TGTCAAGAGGCCATTGTGGAGCTATTGGTGTCAGCGCGCAAGTCGATTTACTATTCGACATTCTTGTGTGATTTCACTCAGATCCTCCACACTACAAACG
AAGAGCAGATGGACAACACGTTCGTATCACTTGTACGCAACGCTGTCACCCGTGGTGTCGATGTGCATATCTTGTACAATCCCATACGCGACTACGGGAC
GAACTCAGTTGCGGATCTACGACTCATTTTGCCTCCTGAAGTGCACTTTGCCTGCTCGGTCAGCGACCTTGGCCCGAGTTGGTTTACGCGCTACATGTCC
AACAATTCGAGATATGCATTCCATCACCAGAAGTATTTGTGCATCGACGAGGAAACCATCATGGTCACAGGCTGCGATGTGAATACTGAACGTGAGGGGT
GGCTACGTAAGAATCATCTCGGGTACTATTGGCACGAGCTCAGTGTTGTTTGTCGTTGCACGGCAGATATGGCGAGATGGGTCCATTCTAATCACGAGTC
CGCAACGAACAAGCGCTACTATGACCAATTCATGGAGTCTCCACCGTTTCCACTGGTTTCCGGTGGTTGGAGAGAGGAAAACTGCATGGTCAACATGATC
ATGAATGCCAAGCATTCTGTGCAATTGGAAAGTCAAATTATGATATCGGGCGGTTCACTACAGCACAACCGCATTTGCCCTGCAATTGTCGCCCGTATCA
GCCAGGCTCGCCGGAAGGGTGAGCCATTCTTCGCGATTATACTAACAAACGCAGCCCAGAAAGATGAGCCATCATTCCTAGCCCGCACATACTGCACACT
TTCCATTCAGTGGTCACTGGAGCAGCTGGAGGATTGTGCGTTGGCGTACGGCTTAACTTTGGATGAATTGTGGCAGCACCTATACGTTGGCCGTCTCGAG
CATGATGGTGTGTTAATCAAGGTACACTCCAACATCCTCATTGTGGACGGGAAATACGCACTTAGATCGTCTTCGAACCTCGCTGACCGCAGTTTAAGTG
CGCGTCCGAACGACACGGAGCTAGGCCTGCTCTTCTCGGGAGCTCGCGTGAACGATCTGCAACAAGATCTTCTCAATATGTACTTAGGCACTACCGGCAA
GACGTACTCGTGGGCACAAGTATTCGCAGTTATCAGAGGTTCTCACACAAAGAAGCCAACCAGGGTGATCAAGAAACTGGAAAAGAAAGCATGGAGCCCT
GTCTTCACGTGGTTCATGATGAATATTTTCATCTATCTTAGTGAAGGTGCGACTGGTGGCCGAGTCAAGGTGACGTACGAGACCATGGTCATTGGCGAAG
ACAAGCACGAATTCGAGACTTAAGGGTAAGACGGATGCTGTGGGGATATTGCAACATACTTCGAAGTAGATGAATGTATTTGCATGATAATCTTGCTAAT
AGCCCATTTCCTTGATGAGATGTTTGTAGCTCGCTTCTTCATGAGCAGTTGACTTTGTGCTTTCGTTTGACCTGGATAGACAATGTTAGCTTACCAAATA
AATCGTAATACAACGTTTCCATGCTGCAACGTACGCTTTCTTCGTGGGAGGTTCCATCTTTAGGAGTTCTAGTAGCTCATTTCGAGCAGAGCGTACCTGA
GATATCTGCCAAATAGACCAAGATACGTTAGCAGTTGTTTGCTGTGTAATCTGATAATGTAAACAACTTACCGAAGCGTCCCATGCTGTATCACTCAAAA
TCTCGACTACTGTGTCGTACTATGCACAGTGGTCACACATGAAACATTAGCTTGTGCAAAGTGACATCATATTAGTGCCACCAACCTTTTCCTCGTCGAT
AATCTCGTCGTGAAGAAGCAATCGTGTGTAAAGTTTCTCCGCTGTTAGTTTCCGCACCTTGGGGAACTTGTGCCCTAGGAAAAGAACCAAGGCACGCAAC
GTTTTTGCCTCTGTTTCAGGGTCACTTGGAAGCAACCCAATCAGAACACTTATCGCTGCACTGAGCTTTGGGACCGCTGTGCACTTTTGAATTTCGTCAC
GAAGTGCTAGGTACAATTTTTCTCCGAAAGCTGTAGGTGTTGTATCGCTTCCGTCTTCTGCTCGCCGCTTTTCGAATAAAAACCGCAGAAGATTAGACTC
CAACATTAACGCCATCGTTTTCATGAGGGGGATCGTAACACGATCGTCTTGGTGATGACGAGTCAACAAAGTGACCAAGAAAAAGCTGAATCGACTGAGC
AGCCCAAAGTCCTTCGCCTGTAAATGCGCACGTACCCACTCAAATAGGGCATCCTTGGAGGCCTTCACTACGCTTTCAGTCAAACCACCAACACTAATGA
CGAGACCTGCTGCGACTTCCTCCATGAATTCCGCAATATCCATCATTTTCACAACCAACGGGAAGGTATCGTGTGCCATAGACCAGTTCACCACCATCGT
CGACGGAAATATTTCCTTTTCGAGTTGAAATCGGTCTGGAATACCGTCAACGCGAGGAGTAGTAGAGTGCAGCAATCGAAATAAAATACCACCTGACGTC
ATCCTCATGTTGTCCAGTTTCTCGGCTAATTGTTTTGCCAGCGCTCCAAACTGAGAAACGAAACAAGTTAGTTGATAATAGAAATAAATGGCAAAGACGT
AGCTTACAATTGTGCCGACAAGATCCGGAGACAACCGTCGCGCAAATGGCATTGCAGATGCTGGGCACACAGTTTTCAGGTTTTCAGTAAGCTTAGAACG
GGTTCCGAAGTCCGGAATTTGGAACACTTCACTGTCAGCGCCATTTTTAAATGTAGCACCTACGATGACAGACAATTTCTTAGCGTGAATAAGTCCCACT
CCACCAGGGCTAAAGTAGTAGTACCCCAGTGTGGGCTTATCAAATTTGACATAGCAAAGCGGATCACTCTCGGACACGCTGCTAATTTCTTCGATCTTGC
GCTTTCGGTCCGATAAACCGTCAATAATGGTGCCTTGGCCATACGCTGTGTGTGCAGTCGCACCAATCAGTCCAAAATACTGGTTTTGTGCGTGTGCGCT
TTCTCCAAGGAGCAATTTCTCAAGACCCAGCATAGCTTCTTTGCGTACCCAGGAACCCACGTCACCTCGCTCATCAAGTCGATAGTCTTGATGGATACAA
CGGATAAGTGTATGAACTATACCGTCTTCCATATCGTTAAGATCAAGCTCGACTGGTGGTCGAGAGCTGAGATCTACCAGTGCTTTAACTGCAGCCACCC
GACTTCCTGGGTCCTCGTCTTCAGTCGGACAATCCCCAACTGACGCGGATTGAATGACAGCAGTCAACACTTCCTTTATGCATGGCTGAACGAGTTCCTT
TGAAGCAACACCTACTGCTCGCAGGAATCCTCGTCGTGCAGCCACATTTGGGTTTGGGACTTCGACGGAATCACCGTTTACTTTGGAGGTTACCGTGATT
CCGGACCTGATGTATCGCGGTATTAATTCCTGCATGAATTTCACATGAACTGGACTCCCCTTTTCAAATATCTTGGGGCAATACTGGGCTGTGAATGCGC
CGAAGGCATCAATAGCCGATTCGCGTACACTCTCATTAGGGTGCACAAAGCATTCTTCCAGTATCGATATATACTTCTTCACATGAGCAAATCCAAGGCT
CAGTCTGGAATTCGATATTACTTCGATCGCATTGCAGACAGCGGTACGAATCATTTCACCGCCGCGACCACGGAATAACCGTCGTTTATCAACCTCAATG
GGCAGCATCTTGACTTTCTTTTGTAATTCTCCGTCAATGTACACTGGTACCTGTGCTAGACACGATAACAAATCAGCGATGCAGATCATAGCACCATGTC
GAACTATCACTTCGGCGTCGGGAGCTAGAGCAGATGTTAAAAGTTGTGGAAAGAGCCTTGTCATCGCGTACAGTGGATCCAATGCACCGATCCTCCCTAG
TACAGCAGCAGCAAGACTGCGAATTTGGATATCCCAGTGAACAATCTTGGAGTCAACAAGATGGTCAAGTAAAGCGTATCGGTACTCTGAATACTTCGCA
ACGAAGACGCTGACGTCCAAGTAGGCATGGCGTAAGTTCGCAACCGAGAAATAATCGGCTTTCGTAAGCAAGTCGATCCCGTTCGGGAAGTTCGTTCGTC
CTTGCCGCCCAACATTTTCTTGGAACGCAGCTGATGCAGCTCGCCGGCAGTTTAACTCACGATCAAAAACACAGTTGACAAGCATCGCTGGGGCGAGAAC
TTGTTTTAACCAAGGTAGAAGCAGCAAGGGCTCATATGCACGCGCAAAAGACCAGCATGCATAGCAAGCAGCGTCCCGCACATGAGAACCAATACTGTAT
GTCCCTTTCCGAATATCATACTTCAATGCATTAGCGACACAGTCCACTGCATCAGGAAGACGCTGCGGTAACAAGACACCCCGACGTGCAAGTTCTGCCA
GCGCCAAGCTAGCTCCATGCCAAGCCCCGTCATCCTCCGTTGCTACAAAAAGTTCGAGTACAGATTGGACGATATCGTCCGCAAATTCGTACGGCAAACG
TCCAGTGATTCGCCCAATTCCTTTTGCAGCTGACCACCTCACTACTGTGTCTTTGTCTCGCAATCCGCACAAAAGGACCTCAACAATCTGTTCCAGCTCT
TCCACCACTTCAAATGTATCGTCGTCGTCGTTGTCGTCGTTGTCGTGTGAACGAATTGGAGTCGATGGGACAGTGTTACCAACAGTAAGCCCTAATGACT
GCATATTAAGTTCCAACGACCTCAGACCACGACTATAGCGCCATGACCGAACTTTAGGCGGCAAGTACAGCATCCCCAGACGCTGAACCAACTTTACGCT
GAGTTTCCGATGCAAGGTGCTGCTACTTGGACGGTTTGAACGCGCATTATCTTCTGTGAGATAAGCCACCAACTTCATAACTGTTGAAAAATAGATACGA
CTAGCCTCAATATGCTGTTCACGAGGCGAGTTCTTGGCGATATGAGCCAAGCAGAGCATAATTCCTGTTACTTTGAACTGCAGCACACGCATATCGTTGT
CATCAGATGCAGTGATGAGTTCTCGATTCGCCCAGTTGAGGAATTGCATCAGATAGTGTTGCTCCATGTCTGGTCGACTAAGTAGTCGTGACAAACACAC
CGCTGCCGCAACTTGAGTAGCTCCTGGGTCGCTCAAATATTCTTTACAGAGTGTGACGATGTTGGATACAATGGAGATAGTTCCAGTGCCATCGTTGCCG
ACACTAGAAGACGACGAGTCGATAGTGTGGAGGTCAAAGGGCACGAGACAAAGCATCGAGAGCCACAACAACAGAACGTAGCGAGTCTCCCACGCTGAGT
GGTCCGTGCGGTCTTGAGACTGCAGCAACTGCAGCGTCGGCTCAAAGTCACTCACTTCATGTGGCAGCAGTTTAACCACCGTCTTATAGCCGCGCACTTT
GCACAGATGGTACACGATCTGGAAGAGTTTGTGCAGTCTCGGGTCGCGATAGACTTGACAAGGGAATGCCACAGCATCTTCATGTGTTGTTCTATGGGCC
ATCACCCGTTTGATCTCCGTCACAACTGGGTCCAGCATCTCGCGTAGATATGGATCCAGTAAATGGGCCTGCTCTAAGTATCTGTCCAGCTACACAAGGG
ATTAGACCTGAGTTAGGGCATTTCAACGAGCATTTGCGTACAATCTGCGTGACGGTGGCATGAGCAGCCAGAAACTCGCGGTCCACGTCGCTCTGAGGCG
TCGGAAGTCGCGTGGTCACCAACTTCTGCAGTAGATCGCGCACTTGCTCGCGCTCTTCGAAGAAGCGTTTCTCGCTGGAGCTCTCGCC