Description :
From Genome Similarity Track
Location :
contig_112:59053- 60432
Transcript NameFunction/comments
g13241.t1ETL97001.1 hypothetical protein L917_05643 [Phytophthora parasitica

Sequence
1379 bases(100 bases per row)
GGGCCAGCCATTCTTCGCTCATATCCCATCGAGCCCAGCCCCGACACAAGTCACTCCCCCAACAGAGCAGGAAACATGGTGCGCGGCAAGAAGATCGGTC
TGGGCGAGTTCCTGGGCGACCAGGCGGCCGCTTACATCCCGGAGGCGGCGCTGCCCTCGGGGCCCCCGCGCGCGCGCCGACGACGACGACGGAAACAGCT
TCCGCGGCGGCCGTGGCGGCGACCGCTACGGAGACCGCGAGCCGACGCGCAGCGATTCGTCGGACCAGTGGCGCGGAGACCGCAGCGGCGGAGGCGACCG
CTTCGGTGGAGGCCGTGAGGACGGTGGTAACTGGCGCGGAGGAGGCGGTGACCGCTTCGGCGGCCCCTCGCGCTACGACCGCCCGGCGCGCGACGACTTC
CAGGCCGAGGAACGCCCCGCTCACATGCGGCTAAACTTGGCGCGCCGCGGAGAGGGTCCCAGCGGCGACGCGCGCAACAGTAGCGGCGACAAGTGGTCTG
GCGCGTTCGGCGGTAACAGCGGCGGAAACAGTGGCGGCCGCTTTGGAGACCGCGGCGGTGATCGCTTCGGTGACCGAGGTGGCGACCGGTTCGGAGACCG
GGGTGGTGACCGCTTTGGAGACCGGGGAGGCGACCGGTTTGAGGGCGGTGGTCGCGCGGCCGGACGCTTTGCGCGCGGAGGAGACGACGTGTCGTCCTCC
TTCTCGAACATGCGCGTGGGCGGGCGACAGGAGCAGGCGGCGCCCGAGCCGCAGATGTCGGACAAGAAGCTGCGCGCTCAGCAGAAGCGCGAGGAGCGCA
AGAAGAAGGCAGAGGAGGAGCGTCTGGCAGCTGAGGAGGCCAAGCGCGTCGCGGCGGAGGAGAAGAAGAAGGCGGAGGAAGAGGCGGCTAAGAAGGCCGA
CGTTGACCGCGAGACCTTGAAGCAGGTGCTAGCGAGCGGCAAGAAGGGCGAGGCCCTTGCGGACGTGGCCAAGGACGTGTTTGCTAAGAACGGACGCCCT
AGCGGCGCTGTGCTCTTCGAGGCGGTGACTACCGCTGCGGAGGACGTGGCCAAGGCCAGCGCCAACTGGATCGCCTTGCCGGCGTATGGCGAGCTGCTCA
AGTTCGGCATGGAGGACGCGGACAAGAAGGACCAGATGGAGGCGCTGTACGCGCTGCAGATCTTCCTGAACAAGCACGACTTCCCCAAGGGTGTGTTTGA
GAAGTGCTTCATGGCCCTGTACAGTCTGGACATTATCGACGAGACAGGCTTCTTCGAGTACAAGTACGACGTGGACGGTGACGTCCCCGGTCGAATGAAG
GCTATTATCCAGACGTCGTCGTGGCTCACGTGGCTCGAGACGCCCGAGGAGGAGAGCGAGGAGGAGGACGAAGAATAGA