Description :
From Genome Similarity Track
Location :
Scaffold_38:59052- 60232
Transcript NameFunction/comments
Hyaar_Emoy2805343unnamed protein product
Hyaar_Emoy2805344unnamed protein product

Sequence
1180 bases(100 bases per row)
ACCGCGCCGTGACGCGGGACGAAGAGGACTGGGCCGCTCGAGGCAACGACGTGGCTGTGGTTTCAGCAGAAGAAGTAGAAGCTGGTGTTGTGGATCTTCC
AGCGTCCCTTAATGGACGAGTAGATGCTTCGGTGGATGTAACAGACGATTATGCTAAGGCCGCTGACTTTGCGGTTCTGGGTGATACCTGTCCCATCTGT
CTAGAGACGCTGGACGACCCCGTTATGGTCAAGGTCTGCTACCACGTCTATTGCTTGGAGTGTCTGAGCACGTGGGTGCACAGTCTGGCTCTGCATGGAG
TGGAGGTAGCCACTTGTCCGCTCTGCAAAGCTTCGTTCCAAGAGGTGTACGCCAACGTGCGGAGCGAGTCGGACTTAGAGGTTGTCTGCTTTCAAGGGAA
GCAGATGCAGAACTGGAGGTTGAGAAGTAGTAGGAAAAAAGACCAGAGAGGGGAATCTTGTCAACGGTTACGACGTCGATCGCTGGTGTATCGACGTCGC
ATGCAGCTGGTTCGAGTGGCTGGAGAGGAGGTCGCAGATGTAAATTCGTTCCCAATGATACGCAAAGTGAAGAGCGAGTACGAGTCGTGGCTAGCTAGGG
AGCTGAACGCGTGTATTGGACGAGATATGGATTTGACAGTGTTGCTGGCTATTATCCAATGCTGTCTGGATAAGGTGGCGCAGTACGGAGCCAAGGTGTG
TTACGATGAACTGCAACAAGCGCTGTTGCCATTTCTGTACGAGGACGCCACGCATTTTGTCCAAGAGCTCGCGTACTTTTTGGCCTCCAGGTTGAATGCT
GAGGCGTATGATGCAGCAGTAGAATATCGATGTGAAAACGCTGCCGAGTGTACAAACGCGCTGTGCTGTGGCAGGTGATCGGGTACGCTCACACCTTGGT
ACGTCTGCAAAGACGTGCTGGGACGCGTAATTTTCATAAACGAGTGTGCAGTCGTTGAATAGAACGGGTCTACCGGCATGATTGAGGTTACTGTTACTGC
CAGCGTCCCTTCAAGTAGTCTATCTATGCTTTGCCCAACACAAGAGCGAGCAGGGCCATGCGCACGTACATACCATTCTCCATCTGGCGAAAGTATGCAG
CGCGCGGATCATTGTCAACCTCTTCGGCAATCTCTCGAACCCGTGGTAGCGGATGCATGATGACCAGCGTTGTCTTTGCA