Description :
From Genome Similarity Track
Location :
Scaffold_6:590447- 592574
Sequence
2127 bases(100 bases per row)
TACCTATAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCGTGAGACTAAATACTGTGTCACACGACAGTGGCACTTGCCTAAGGAGCAATGTGATGT
CATTGATGACTTCTTCCGTGCCAAGCACAAGGCAGGAATGGCACGCGAGAGTAAATATCCACATTCGACACCGAAATTTGTGTCAAAAAGCCGAACGGCA
AGTGGCGTATTGTACATGCTTACAACAAGCTTAATGCGGTCACTATTCCGGCACAGACACGTATTACTAGAAAGGACGTTCGTCAAAACAACATGGTTGG
TTGTACCCTGTACATGGCACTCGTCTTAGTATATTTTAATTGCTCATTGTTGAAATCACATCGGTCATTTGCGAGCCGTTCTCGAGTGCATGCACACTAA
TAAATTGCACGCAAACGCGTCTAAATGCATTTTTGGTGCAGAGGAGATTCCTTTTTTAGGATGTTTCATTGGTAAGCACGGCCTTAGAGAGGATCCCGCT
AAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCCTTGCCATTTACTTACACAAATAAAGTGAAAATT
ACGCTGACACGACTTGGCCATCAAATGATCTCCTTAAGAAGGACACTTCTGGGACACGACCCATGCTGACGCATTTCGGGAAATAAAGGAGATTCTCCTC
CATGCTCATATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGATGCATCCGATTTTGCTATAGGCAGCGCCCTGTTACAAACAGATG
CTGCATGCCGCGAGAGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATGACGAAGAGCTACTTGCTATGAAGTA
TGCGCTCATCAAATTTAAAGTCCATCTGCTTGGCTCCAAGCCATTTGTCGTCTACACGGATCGTGCGTCATCGCGCACGGCAACACAGTCGCCTCACCTC
TCGCAGAAAATGGCTCGTTGGATTTCCTTCTTTGCGGAATATGATTTTGAGGTGAAGTATAAGCCAGGCAAACAAAATGTGCTGGCAGATGCCCTCTCTC
GCAGACCCGATTATGAGCTTGCTTATGTCACGACTTTGTCGTCTCCTGTTGAGGAGTTCATTCGTGTGGCATATCCACGGGATTCTCAATGTGTGGCATT
GTTTCATGCCCTTGGGAGTGAGGAGTACAAAGACTCGGACAGTAAATTGTCGGCACGGTTGCGTACCAGCCTACATCGATATTCCATAGATAATGGTCTC
TTTAGCTATCGCACAGATGTTACGGATACCGCTCGAATTGCTGTACCTCATAATGAGGATTTACAGTATCAGCTCATCTTTGAGGCCCATGATACTGCTC
TCAGTGGGCATTTGGGCCGAGAAAAGACTTATGGCTCTGTGAGTCAACACTACTGGTGGCTCAAAGTCTACAAATGAGTGAGCACATACGTGCGTACATG
CGAAACGTGCCAGCGGGTCAAAACCTCAGCACATTCGGCTGCGCCACACGCCAGTTTATCTGTGCCCACGGGGTGTTCGGAGTCCGTCAGTATGGATTTT
GTGTTTGGTCTTCCTAAAGACTGTGACGACAATACGGGAATTGTGGTCTTTGCTGGCCGTTGAAGCAAGATGGCTTAATTGGCGGCGGCACCGATTTTTC
AATCGATGGTAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTCGTCAACACGGGTTGCGAGCAATCATCTCTGATCTCGACCCTCGCTTCACAGGC
AAGTTTTGGAATTCCATCTTCACGGTGCTTGGCACGCGATTGGACATGTCCACAGCAGATCATCCGCAGACCAATGGTCTGACTGAGCGAGCTAATCGCG
TCATTGGCGACGTTCTTCGCAGTGTTTGTTCTGAGTCGCCTAAGCCTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAACAACGCTGTTCATGC
CTCGACCGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACACCACGTTCCACTCACGTTACCACACCGTGGTTCTGGGCTTGGTGGGGGGAGGGTCT
GCTGACAAGCTTGCTGAAATAAGTCAT