Description :
From Genome Similarity Track
Location :
Scaffold_1069:5904- 7320
Transcript NameFunction/comments
g12092.t1RAW24820.1 Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Phytophthora cactorum

Sequence
1416 bases(100 bases per row)
TTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGA
CCTTCGCACCCGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTAGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTT
CCTCGACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGCCGAAGACCACCCGGACCACGTATGCAAGCTCAAGCGGTCGCTG
TACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACC
TCAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTCGACGACTTGGTCCTCGCCAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGC
GTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGCCCGCGACTCCGGAAAAGTGACGGTGCGG
CAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACA
TGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGCAGTGCCGTCGGTGCTCTCATGTACTTGATGATGGCAACGCGTCCGGA
CCTGGCTGCTGCAGTGGGAGTACTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACG
CCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACACCGAGTCAAGACGGAGCACAA
GCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCGACGGAAGCAGAGTACATGGCGCT
ATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAA
GGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGAGCGAGAAGGTGGAAGACGGCCAAG
TGGTGCTGCAGTATGTGTCGACAACCGACATGCTGGCGGACATCATGACGAAGGCAATTCCTGCAACGCAGTTCCATGTGCTCCGGACCAAGCTCGGGAT
CCAAGGTGCAATCGTT