Description :
From Genome Similarity Track
Location :
Scaffold_52:59037- 61922
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10116aldehyde dehydrogenase, putative
Sappa_CBS223.65SPRG_10117carbohydrate esterase, putative
Sappa_CBS223.65SPRG_10118cysteine protease family C26, putative

Sequence
2885 bases(100 bases per row)
CCGTGAACGAGACGAACTGCACATCGGGATGCGCAATGGCATTGGCCGCCGTGCCATGGGCCATTTGCTCGGCGCGGAGGAGGTCGACGGGGAAGCCCGC
GGCCTCCAGCGTCGATTGGAAGCGGCGGCCGCAGAGTGGCGTTTGCGGCGAGTGCTTAAGGAGCACGCCGTTGCCAGCAAGGAGCGCCGGCAGCACCGAG
TTGACCACCGTCATCATCGGGTAGTTCCACGGCGCGATGACAAAGACAACGCCGACAGGCTCCTTCGTAATGCAGCGGAAGAGCTTGTCGTCGTCGTCGT
GCGGAAACGTCGTTGGGGCCAGCGCCTTCTCCGCGAGCGCAATCATGACCCTAGATACGCATGCGACGAGAGATGGTACGAAGAAAGAGATGGCGTCGAC
GTACTTGGCCCGCTGGATCGTGCCACGGACTTCCCCCTTGGCCTAGACGGGGTCGCGGAAGAGGGTGCAGTATACAAAAGGACGCACCTGCGCCAGTGGC
TTGCCCATTTGCAGCGTAATCTCGGTCGCGATCTCGTCGACTTGGTCGTTGAGGACGTCGACCCACTTGGTCGCAATCGCTTGGCGTTGCGCGAGCGTCG
TCGTCGCCGCCCAGTGGCGCTGCGCTTTCTTTACGCGATCGATCGTGTCCAGGACGCTGGCCGAAGACGCTTCCGTCACATGCGCCACGGGCTCGAGCGT
GTACGGGTTCTCGACAGCAAACCTACAGCATCGTACGCTTCCATGCTCGACGTCACGGCCTACGTGGTGGCCGAGGCGAACGTCGCCGCGGGGGCGCGCG
CCAGCTTGGTCGTCTGCCGAAGCACTGTCTTCTACGATCGCATGCGCGGATGAGGCCATGCACCTCCTGCCTGCAGCCGTCTACCTGCAACGTTGGCCAC
ATGCTTCGTCGTCGTTGGGCCAGATAGTCACTACTTGAATCTTGCCCAAGCCCAAGTAATAGGCTTGAGTATGGTATACAAACAGCAAGCTTCTTTCTTG
GATACGTGATGCACCAATCAGCGGCCACTTGAAGTGGCCATTGCGATCTTCGACTCTGAGAACGAACGCAGACGGCGATGGGCGGTCTACTTCAAGCCAA
AGCCGTCAGCTGGCAGAAGAAGCAGCGGCTGCTTGGACTCTGGTTCTTCTTCTACCATCCTACTAGAGTACCATGGAAGCCACCGTAGACATCTGGCGAC
CGAGGAATGCTAGACGCAGGTATGCACTCGATTAGGATGCTCGTTAACTAGATCTCGCTGGGGCCGCCGAACGGGTCGACTTCGGTCTCGCTCGTGACGT
AAGCGGCCGTGATACCGCCGTCGACCATGAACTTGGTGCCAGTGATGTAGGACGCATCGTCGCTGGCGAGGAAGAGCGCGGCTTTGGCCATCTCGGCCGC
CTCGCCAAAGCGCCCCATCGGCACGTGCACGAGGCGGCGCTGCTTCTTGGCCTCCGAGTCGAGGAACTTCTGCAGCAACGGCGTGTTGAGCGGGCCCGGG
CACAACGCGTTCACGCGAATGTTCTCGCGGGCGTGGATGACGGCGAGCTCGCGGCTGATGGCAATCACCGCGCCCTTGCTCGCCGTGTAGGCCAGCTGCG
GCGTCGCTGCGCCAATGCACCCGACGAACGATGCTGTGTTGATGATCGAGCCGCCGCCCGCCCGGCGAAGCGCCGGGATCGCATGCTTGCAGCCAAAGAA
GACGCCTTTCACGTTGATGTCCATGCTATGCCATATAGCTATGAGCAATCGAATGTGCGCCATCGAAGCACGTACGTGAGGTCCCAAACCTTTTCCGAGG
TCGCGATCGCATCGTCGTCGTCGCCGTGCATGATGCCGGCGTTGTTGAAGAGCACGTGGAGGTGGCCATACGTCTTTTCGGCAGCATCCACCATGGCCTT
GCACTCGTCGCTCTTGGAGACGTCGACGCGGATCGCGGTCGCGACGTTGGGCTTGCCCACGAGCTTGGCAATCATGTCGGCTGTTTCCTGCGCGGCTTCG
AGGTTGAGGTCCGCGCACACGACGCCTTTCGCGCCTTCCTTGGCAAAGAGCAGCGCGCTCTTCCGGCCGATGCCACCGCCGGCGCCGGTCACGATCGCCA
CCTTCTTCGCCACGCGCCCTGCCATGCTGCTAAGACTCTAAATCCAAAATGAGCATCTTCAACTGCGATCTTCCAGCATGAAATCGCACTGCAATATAAT
GATCTGATCTGCATCATGTATAGAATCTTTATGAGAATTAAATAAAACGCATGATAATAATTTCCATTGAAATCGTGTTTCTTTGCAATGGTCCGCGTTG
GCCATGACGTGGCCCTTTGCAGCCCCACCCGGCGAGAATCTGTCATAATATTGGAGCATGGAATAAAAATAGATGCGCCAATACACAAGATAGATAATAT
TATAAAGGAATGAAAACGAAATAGAATTGTATTTTATGACCCATAAGATCTGAACCTGCAACCACTTTGCCTTTGTCGCCCGAAACCGCAATGCTCGTCC
GAGCGATCTTCCCGCGGGCCCGCGCCCTCTCGACGAGCGCTAGCAGTCTTCGCTTCCTCATCGTCGAGGGCTACTCGCCCGAAGGCCGCGCCGAGCTGCA
GCGGGGCGGTGCCACGATCGCGTCCGAGCTGTACGCGAACGTGCTCAAGACCGTGTCGCCGATGGCCGTGACCCACGACGTGCTGCACCCGGCAGACGGC
CCGTTCCAGGCACCCGACTTGAGCAAGTACGATGGCGTCGTCTGGACAGGCTGCAGGTACGCGTAGCAATACTGTCGTGACCGTCCCACCTACCGACCTC
GCGGTAGCTTGACGGTCTACGAAACGGACGACGAGCGCACGGTGCGGCAAATCGACCTCGCCAAGCAGATCTACGCCTATGGTAT