Description :
From Genome Similarity Track
Location :
contig_112:59037- 60416
Transcript NameFunction/comments
g13765.t1POM59465.1 hypothetical protein PHPALM_31806 [Phytophthora palmivora var. palmivora

Sequence
1379 bases(100 bases per row)
GGGCCAGCCATTCTTCGCTCATATCCCATCGAGCCCAGCCCCGACACAAGTCACTCCCCCAACAGAGCAGGAAACATGGTGCGCGGCAAGAAGATCGGTC
TGGGCGAGTTCCTGGGCGACCAGGCGGCCGCTTACATCCCGGAGGCGGCGCTGCCCTCGGGGCCCCCGCGCGCGCGCCGACGACGACGACGGAAACAGCT
TCCGCGGCGGCCGTGGCGGCGACCGCTACGGAGACCGCGAGCCGACGCGCAGCGATTCGTCGGACCAGTGGCGCGGAGACCGCAGCGGCGGAGGCGACCG
CTTCGGTGGAGGCCGTGAGGACGGTGGTAACTGGCGCGGAGGAGGCGGTGACCGCTTCGGCGGCCCCTCGCGCTACGACCGCCCGGCGCGCGACGACTTC
CAGGCCGAGGAACGCCCCGCTCACATGCGGTTAAACCTGGCGCGCCGCGGAGAGGGTCCCAGCGGCGATGCACGCAACAGCAGCGGCGACAAGTGGTCTG
GCGCGTTCGGCGGTAACAGCGGCGGAAACAGTGGCGGCCGCTTTGGAGACCGCGGCGGTGATCGCTTCGGTGACCGAGGTGGCGACCGGTTCGGAGACCG
GGGTGGTGACCGCTTTGGAGACCGGGGAGGCGACCGGTTTGAAAGCGGTGGCCGCGCGGCCGGACGCTTTGCGCGCGGAGGAGACGACGTGTCGTCCTCC
TTCTCGAACATGCGCGTGGGCGGGCGACAGGAGCAGGCGGCTCCCGAGCCGCAGATGTCGGACAAGAAGCTGCGCGCCCAGCAGAAGCGCGAGGAGCGCA
AGAAGAAGGCGGAGGAGGAGCGTCTGGCCGCTGAGGAGGCCAAGCGCGTCGCGGCGGAGGAGAAGAAGAAGGCGGAGGAAGAGGCGGCTAAGAAGGCCGA
CGTTGACCGCGAGACCTTGAAGCAGGTGCTAGCGTGCGGCAAGAAGGGCGAGGCCCTTGCGGACGTGGCCAAGGACGTGTTTGCTAAGAACGGACGCCCT
AGCGGCGCTGTGCTCTTCGAGGCGGTGACTACCGCTGCGGAGGACGTGGCCAAGGCCAGCGCCAACTGGATCGCCTTGCCGGCGTATGGCGAGCTGCTCA
AGTTCGGCATGGAGGACGCGGACAAGAAGGACCAGATGGAGGCGCTGTACGCGCTGCAGATCTTCCTGAACAAGCACGACTTCCCCAAGGGTGTGTTTGA
GAAGTGCTTCATGGCCCTGTACAGTCTGGACATTATCGACGAGACAGGCTTCTTCGAGTACAAGTACGACGTGGACGGTGACGTCCCCGGTCGAATGAAG
GCTATTATCCAGACGTCGTCGTGGCTCACGTGGCTCGAGACGCCCGAGGAGGAGAGCGAGGAGGAGGACGAAGAATAGA