Description :
From Genome Similarity Track
Location :
Scaffold_96:5903- 7428
Transcript NameFunction/comments
g7468.t1hypothetical protein

Sequence
1525 bases(100 bases per row)
TCCGGGCACGCGCACCATTGTGGTGGAGCGGGATCACGAAATTGCTGACGCGATTGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGT
ACTCCGTTGACCCGGCGGATCTTGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAGTCAGT
GGTGAACAGGGCAGAACTGGGGCTTGAGGGCCTTCAGGTATGGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTCGGGTGACGAT
CGTGTGTGATCGATCACGGGGTGTGTCCTTTACGGGGTCCTTTTCGATGCTTGCCGCCTCCTACGGCGGGATCTTGATGAGTTGGAGGGAGAAGGGGAGC
GCACCTGGCCAAGCTATCCAGGGGCTTCCGCGTTCTCGCTTGAGTCACTTCAGGTGGTTGTCCGGTCGTCGGGTAGGCCAATATATTTCCTTCCCCGGAA
TTCGGAAGACCACTTGCGTGCTACAAGGAAAATCTCTCTCTGTTTATCCATTAAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATTGC
TGACATTCTTGGACCTCCGATGTGCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAAACTGATCGGTCGATCGGAACCCAT
GTTGATCCGATCGGTTGATCTGAACTCATGTACCCAACATGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATTCACCGTCCGGT
CGTCCGACCGTTGATGCCGCCCATCCCAGGTCCAAAGCCATCCATCCGTACCCATCAACCAATCACCTGGTCGGACACGATCAATCCATCTCCAAAACCT
TCTGGTCACTTCTCCACAAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTTGTCTCCAACTCCTATGTCTGCCCGGCAGACAATGCTTGTAAC
GTCTCGGTCTCTGACCGAGACTTGTGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGACTCCGCGAGTTTCTTCTTGTCCAGGCCCGG
CCGTGGACAGTTGTTCCTTGTATTCGTCGGCGGGTTCTACCCGCGGGCGCACGTGTTCAAGCCCGGCTTGATCGCGTACCGCTTTGTCGTGCAGCCCGGC
TGCACGCGAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTTCCAGAGCCGACGCGCCTTCTTGACCTCGACGCCTAAC
GGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATCCGATCGAATCAGG
CCCTGCTGATTCGGTTCACAGTTTCTTCCAACGACTCTCGCAGTCGTTGGTGTTCGTGTGGGGTGATCGGAGACAGCCGCATCCCGCGCTGTCTCTGATG
GAGGGCCGCATGCACCACGCGGTGC