Description :
From Genome Similarity Track
Location :
Scaffold_80:59011- 61766
Transcript NameFunction/comments
g8359.t1hypothetical protein

Sequence
2755 bases(100 bases per row)
GTTGAACCTCGTGTTCTCCTGGCCAATACGGTACAATAGCGGATAGTTGTGTGCCAAGCAGGCAGGCACATCCTGTTCGAAGGTGCTCACGAGTACGATA
GGTAGTGCTGTGAAGAGCAGATTGTAGCCCTGAAGCCCCCATTCGAGGAAGAACTTCTGTCCCGAGTAGCCCGTGTAGATCATGTACCAGAACTGCGTCA
GGTTCAGAATCACATTCTTGTAGAAAATGTACAGGATCAACTTGCCCATGCGCACGTAGTTCCATCGTCCGTGGACGAGTAACAGTCGGGACAGGAAGCG
GAACTGCGCGATGGCATAGTCCGATGAGTTCGCAGCCTGCATACCTTCCTGTCCAGATATACCAACACCCACGTGTGCGGCTTGAATCATGGAGACATCG
TTGGCACCATCACCGATGGCCAGAGTTCGGATTTCAGGGTTGTTGTCACGAACCAGTCGCACCAATTGAGCCTTCTGGGCAGGAGACACACGACAAGCAA
TCACTGCCACGCACTTCTCCGCCACCTTCAGTAGTAGCTCAGGGCACTCTTCCAGCGCAAGCTCCAGTGTTTCGCCATCAATCACCAGCCCCAAATCTTG
TTTTGGCATCTCCGCCATGCTCTCGATGCGGGTCATTCGCTTGCGCTGGTTCCGAAGCGAGACCGAGTGTCGAGCCTCTGACGAAACCGATACACCAAGC
GCTCCAGCTGCTGTCGACGCCGAAGTGTCTTCATTGTCATCCTCACGGTTGTATGCTTCCAGCTCGTCCATGATGCTAGCCAAGTCCGGGTGCGTATCCG
CCGAGATCACAATCCGCTCGATGTCCGAGGCGAGCAGACGGCAAGCAAAGCCGATGTTGATCGCTGTCTCCTCCTTGTCACCAGTAAGCATCCAGATCTT
AATGGATGCCTGACGCAGTTTGTAAATTGTATCAGGGACTTCTGCCTGCAGCCGGTCCTCAATTGCAGTCGCACCTAAAATGTCCAGATTCACCTCAATT
TCCTCCATCAGCCGATCAATGTCATTGTCCTCGCCATTGCGACGCAGGTCGATCTGACGCATATCGTTGATGGCTGTGCGGTAGCGGATCACCCACGACT
CAAAGAACGCCGGATCAATGTCCGTCATGCCAATCACGAGCGTTCGCAGACCCTCCGACGCAAATTGCTCCATGTGCTGCAACGTCAGGTTGCGCGTCTG
CTTGACAGCAGGGTCGTTCGTCGGTCTCAAGCGCTCGTACATGACGGTGTCCGCTCCCTTGCAGAACAGTTTCAACTCGCCGTGGGGGGCCTTGAGGATG
ACCGACATACGCTTGCGTGTGCTGTTAAACTCGAGTACCTCCAGGATCTCGTAGCCGCCAACAGGGTGATCAGCAACCGGCTGATTGCACGTCATCTCTT
CTGGGCGATCGACGCAAGAAAAGTACTCGACCATCGCCTTACCAGGTCCACGAGCCACAAACTTGTAGCCAAAGCACGCAGCCGCAGCGACCAGCGCTTG
CTCATCCGGAGAAGACGCACTCAAGCGCAGACTGTTGTCCGGGGCCTTTTCCGGCATGACTGTGTGGCACACTGCCAAATGCTCAAAAAATGACCCAATT
GACTTCGCCTGGACACTGTTCTTCTGCGCCAGCGCTTCGAACAGTGCATCGTCCTGGTAGTTAACGAAGGGAGCCTTGACCACACGATCCGTCGGAGGAT
TGTTCGAGTCCGGCGCAGTATCAATGCGGTCTTTCCTCATCGGAACCGCACAGCCGCCACCGGGAGTTACTGCAAAAAACGAGGACGTCATCGGTGCTTC
TTCCTGCTGTCGCTTCCTGGCTGCAATACCCACCTCCGTCTCGCCCATGCCATACGCGACGCCATTGATGGAGCACTTGCGGAACTCCATAATGTTGCAC
GTCAGGGTGCCCGTTTTGTCTGAGAAAATGTAGTCGATCTGACCGAGCTCCTCGTTCAGAGACATCGTGCGCACTTGGCACGGCGTGTCCGTCTCGTCGT
GGTACATTTCCAGGTCGTTGTTCATGAAATACGACTGCATGAACTTCACGGACGTCATACTCACGTACAGCGACACGGGGATGAACGAGTTCAGCAGCAA
AAAGTAGTAGAGCACCATGATGAAAAAGCTCCCCGTGGGCGACTTGACGGCCGTCGAGTTGCCATCATACAAATACCACGCGGCCTTGTGCGCGTCCTTG
TCCAGATTTTGAGCGTTCCAGACCGTCGACAAAATTGCGCCCGTGAGGCACAGCGCCACCATGAGCATACAAATGTACAGAATCTGCTTGTTCAGGCGCT
TCTCCATGTTGCTCCACTTCATGGGCTCGGACGACGAGGCCATCATGATCTTCGTGTCCGGGCCCGTGTTCACCACGAGACCATAGATGTACTCCGTGTT
GCGCAGCGTCGAGCCGCGCAGCACGATGGCGTTTGTCGTGATGACCTCCTTCTTGCCCCCCTCGAGCGTCATGGAGCCGCTGAAGCGGTGGATCGCGTTG
TTGGGCGTCTCGCACACGACGGTCCCCTTCAAGTCTCCGACCGCGGCGTCACTCAGCAGCGCCGTGTACGTGGCCTCCAGTCCCTGTCTCAGCTTCAAAT
TGGTCTCTCCGTCCAACGATTTCGTCTCCACGTAGCAAATGCCCGCGGGGTTCGTCGGCTCGGGCTCACAGGCTCCTAGAATCACCAGGTCCGCCGGGAC
CGGGTCTCGGTTCGCCACTTTCACCACGTCCCCGACCTGCAGCATGTGCCACTTG