Description :
From Genome Similarity Track
Location :
Scaffold_1123:590- 5647
Sequence
5057 bases(100 bases per row)
AAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGGGGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCATGTGTGGTCCATCGAGTGA
GCCAAGATGGATCGTACGGAGTTTCCCCATCTGATCGACTCGCAGTACGAGTCCGTTCGTAAGATGACAGGCATCTTTGGGACAGATGCCCTGCGTAGCT
TAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGCGGGCTCATCGCCCACGTTCAAGGGCTGCAGGCCACTGC
GGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCTTTCGAAGGGAAGGAAGGAGAAAACCTTCACTTCTGGGTTCGAGAGGTT
GAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAGAGTTGGGCGTATACGC
GCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACTACGAGTACCGCCAGCGTTC
GCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCTCTGTCTCTTTGGTGGGGAACCCCCTGCCTGAA
CACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAGCTGTTCCGTGTGCAAGCAAACACTATGGAGGAGGCGATTCAGA
TCGCCCTCCAGGAAGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCACGGTATGTCAGAGCAACCCTGTCTCTGGCGGTGCGCCTAATGGTAACTCCGG
CAATGGAGCGATCAACCGGCCGGTTCCCATGAATCTGGGCATGGCCGAGCAGAGCGACATTCGTTGCTACGGCTGTGGCAAGCTTGGGCACATGAAACGT
GCTTGTCCCGCGGAAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCG
GACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTTAGCCCCTGAGAGTCTC
TGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGG
CGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTGCGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTCGGTAAG
ACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTAGAC
ATGGACAAGTACGACTTGATCCTTGGTATGCCGTGGCTGGAGAAACATGAGCCTTGGATCGACCGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCAC
GCTCTGACAGAGCTTTGATGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCACCCGCGAGGGCCCCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGG
GTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACGTAGGTCCACACGCG
GGTAACGAAGTACCGCAGACAGCAAGAGCTGCTGGAGAAAGCGCCGCTGGCGTTGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAAGGACAAGGCGGGTAACGTAGTTCTGCACGAGATCGAGAAGATCGGTGGT
GCCGTCAAGGCCGCGCCTCGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCTAGTCGCCAGCGACTCCGAGC
CTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCC
CGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCG
GAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGGCATGGACCAGGCAGTCCTAGAGGAGTTCCAGAGACAGCGTGCGTCGCGCATGGGCTCTGAGATTC
TTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAG
GCACGAGATCGATCTCTTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCC
AAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGTGTCTGGTTCATGCTT
ATAACAAGCTGAACAGCGCGACGGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGTCGGCTGCACGCTGTATAGCGCGCT
GGACCTGGTGGACGGTTACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTTACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTC
ATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCAACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACA
TCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTA
CGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAA
ACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGC
TGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCG
CGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGAT
GAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCATCCCAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACG
CTCTTGTCAAGTTCCGAGTCCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTC
ACAGCGGATGGCGCGTTGGTTGTCATTCTTCACGGAATACAACTTCCGTGTCGAGGACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGC
CGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGAACGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTG
TGCGGTTCTTGACCGCTGGCTCGGAAGCCAATGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCA
CTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGT
GGCCATCTCGGCCGTGAGGAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGA
CGTACCAGCGCGTGAAGCCTGCCGGTCACGCCTCGACACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTT
CGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACATCGTCACT
GGCGACAAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGT
TCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCT
CGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCG
ACGGGCTTTACGCCCTTTAACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTAGGGGAGAGG
CTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAAGATAATCAGCAG
GGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTT
CTCCTAGATATTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAG