Description :
From Genome Similarity Track
Location :
Scaffold_1092:590- 4143
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1092-fgenesh-gene-0.0Phospholipid-transporting ATPase

Sequence
3553 bases(100 bases per row)
CGGCAGCTCAAGGGCGACTACCGCATCGTGCACCTCAACGAACCGCATAAGAACACGGAGCTTGGCTACTGCGACAACTTCATCATCACGTCCAAGTACA
CCGTGATATCGTTTCTGCCGAAATTCCTCTTTGAGACCTTCCGCAAGCTTGCCAACCTCTATTTCCTTGCGATCTGCATCATGCAGTGCATCCCGACGAT
TAGCAACACGAACGGACAGCCGTCGACACTGCCACCACTGGCATTCATCATCTTCGTTGACGCCGTGTTCGCAGTGCTCGAAGACCACAAGCGCCACATC
GCAGACAACGTCGCCAATTCGCGTCCGACCAACGTGTTTGATGCCTCATCGAAGGTTTTTATCGCAAAGCACTGGGCTGATGTTGTCGTGGGAGACATCA
TCCGCCTCAACAACCGCGATCTCGTACCAGCCGACATCCTCGTGCTTGCAGTCAGCGAACTGCCCGACGCGCCGCCCTCGGGGATCTGCTACGTCGAGAC
TAAGTCGCTCGACGGCGAGACCAACATGAAAGTGCGCTCTGCGATGGAATCCACGCTCGCCGAGATGGGCTCGATCGACAATTTGCTCAAAGCGAAGGGC
GTGGTCCGCTGCGAGCATCCAAACAACGCAATCAACAGTTTCCAGGGTATACTAGAGCTGGCCGGCAAGGAGAAGCAGTCGATTCCGTACGAGAGCATTA
TTCTGCGCGGGTGCATCATTCGCAACACCGACTGGGTGCACGGCGTCGTCCTCAACACGGGCAAGGACACCAAGATCATGATGAGCAACTCGGCGCCACC
CTCCAAAATGAGCACCATGGACCAGTCCATCAACCGGTACATCGCTGCGCTGCTGGTGATCCTGGTGTTGTTCAGTGCAGTTGGAGCCTCTGGCGCTGTG
ATCTGGAAGTCTGCGAGCCACAAGCCGTGGTACTTGGCGCTGGGTGAATCGGGAAACAGCAAAGGCATCGACTGGATCATCATGCTCTTCTACTACATGC
TGTTGATGTACCAGTTCGTGCCCATCTCGCTCTGCGTGTCCATGAGCATGGTGAAATACCTCCAGGCGCAGTTCATCCAGTGGGATAAGCAGATCTACCA
CGACGCCACCGACACGCCCACGCTTGTGCGTTCCATGTCGCTCAACGAAGAGCTCGGACAGATCTCCTACGTGTTCTCGGACAAGACTGGGACGCTCACG
TGCAACGTGATGGAGTTTCGCAAATGCTCGATCGGCGGCGTCTCGTATGGCAAAGGCACGACTGAGATTGGTCTCGCGGCAATGAAGCGCGCGGGCAAGC
CACTTCCCGTGATGGATTCGCAGCAAGGCGGGAAGATCGTTCCGTACGTCAATTTCGACGGACCGGAGCTCTTCGACGACATGAAAGGGAACTCCGGCGC
TGCTCAACAGCGTCGCATCGACGCGTTCTTCACGCACTTGGCGATCTGCCACACAGTGATCCCGGAGCGGCGAGAAAACTCGACCGAGGTCACGCTCTCC
GCATCTTCTCCAGATGAACAGGCGCTGGTCGCTGGTGCTGGATTCTTTGGCTTCGAGTTCATGAACCGCTCGCCAGGGGTGGCGCACGCCAAGATCCATG
GAACCAACCACCAGTTTGAGCTCCTCGATATCTTGGAGTTCAACAGTACTCGCAAGCGCATGACCACGATCGTGCGCCATCCGGACGGGAAAGTGTATCT
CTACACAAAAGGAGCCGACGCGATCATCTTTGCGCGCATGGCCAAGGGCAACAACAGCGAGTCGGCTCAGCTGCAGGACATTACACGCCGCCACATTGAC
GCGTACGCTGAAGAAGGGCTGCGTACGCTCACGATCGCGATTCGCGAGCTCGACCCGACGTACTATGAGCAGTGGGCGATCCGATTCCACGAAGCGCAGA
ACAACTTGGCAGAGATTGACAAGCGCAAGAAGGACCTTCCCAACGCCATCGACGACTGCATGGACGAGATCGAGAGTGAGCTGGAGCTTCTCGGTGCGAC
CGCGATCGAAGACAAGTTGCAGAGCGGCGTGCCCGACACCATTGCGAATCTCGCGTGCGCTGGCATCAAGATCTGGGTACTCACGGGCGACAAGGAGGAG
ACCGCGATCAACATCGGCTTTGCCTGCCAGCTGCTGACGAACGACATGACGGTTCATATCATCAGCGCCAAGTATTTTCCAACACCAGAGCTCATCGAAG
CCGAGCTCACGGCACAGATCACAGCGCGTAGTGCCGACGTACAGAGGTATCTCGAGTCCCCCGTGGCGAGTCGCGGTGAACTCAAGAGTATCGCGCTCGT
GATCGATGGCGAGACGCTCATCCATGCACTGACCGGGATGTGCCGCTCACTGCTCGCCGAGTTCTCGCAATACTGCAAGGCCGTCATCGCGTGCCGAGTC
TCGCCCGCACAGAAAGCGCAGATGGTCGCGGTCATCAAGGAGTACGTGCCCGGGGTGCGCACGCTCGCGATCGGCGATGGTGCCAACGACGTGTCCATGA
TCCAGGAAGCGCACATTGGCGTGGGCATCTCGGGCCAAGAAGGGATGCAGGCAGTCAACTCGAGCGACTACGCGATCGCCCAGTTCCGCTTCCTTGAACG
CTTGCTGCTGGTGCACGGGAGGTGGAACTACCGACGCATGTCCCAGCTTGTGGTGTACATGTTCTACAAGAACATCCTCTTCACGGCCGCACAGTACTGG
TACACGCTCATGTGCGGCTTCTCGGGCCAAAAGTTCTTTCTGGAAACGGGCGTGCAACTCTACAACATCTGCATGACGTCGATCCCGATCATCGCGCTCT
CGATCCTCGATCAGGACGTGGGCGACGACCTCGCGATGAAGTTCCCAAAGTTATACTACGTCGGTCCACGCGACGAAGATCTGAACAAAGGTATTTTCTC
GCTCTGGGTGCTGGGGGCGATCGTGGAGTCCGTGATCATCACGCTCGTCGTCGTGAACGGTGTTGAGAATGGCGGCTACAGCGGCAGCAGCAGCTCCATG
TGGCTCGACGGCAGCATCACCTTCACCATGGTGGTGCTGGTCGCCAACGCGAAGCTCATGCTCTTCCAGAACAGCTTCCACTTGTTCAACCACGTGCTCT
ACTGGGGCTCGATCATCATGTGGCTGCTCGTGGCGTTCTTCGCGGGCCACGTCACGATGCTCTCGGATCTCACGTGGGAGAAGATGCTCGAGCAAATGTT
CAAGGCCAATGGCTTTTGGGCGCTTTTGCTCTTCACACCGATCGCTGCGCTCTCGTACGCATACCTGATCAACGGACTCAAGCTCACGTTCGCTCCCGAG
TACTGGCAGCTCGCAAAGGAAGTGATCAAGTTCGACCTCAACAAGCAGCTTCTCCAGTGGGACGACAACACGAACGCGTCCGTGCCGGTGCCGGTCAAAC
CAGCGCGCGGCAGATCGAAAGGACGTCTCGGACTCGTCGTACCGACAAACGCAAAGAGCTCGGCAGTTTGGAATATTCTCCAACGCCCGCATCGCGGATT
CGCATTCTCGACGGACTCGCACGCTCACGCGGAAGAAGCCCACATGACAATGA