Description :
From Genome Similarity Track
Location :
Scaffold_1327:590- 2946
Sequence
2356 bases(100 bases per row)
AAGcacaggacgaggaggcgtGGATCTCTGGGCTGAAGAAGTATTTAGCCGGAGATGTAAGTGGTCTGGATCAAGAGGAAGCGAGACCTACAGTGGTATT
GCTATGATTACGAGGTGGACGATCATGATTTACTATTTCTACTGCCCTTCTCCTAGAAGGTCAAACTCCGATCGGACTGGATTGATGAGGCTCGTGGCCC
CAGAGACACTCCACCAGGATATTCTACACCACTATCACGCGAGTATAGAAGGAGGCCACCAAGGGATCAGGCGTACCTACTTGCGCATTCGAGATCATGT
CCATTGGAGAGGTCTCTACCGGAGTGTGCAGCAGTACGTGGGGAATTGGGTCGATTGAGAGACGGGAAAAGGGAAGCCGTCGATCCGGGGTGAGTCACCT
GGGAATATCCAAGCGACCCACCCGTTTCAGGTCATAGCCATGAATCATAGCCCTTCGCTGCCTAAATCATACAAAGGcaacacggagctgctgatctggg
TAGATCTGTTTACAGGGTATGTAATCGCTAAATCTAGCGCGTCCAGGACGGCTCAGACGATTACCGAATCTTATGAGGAATGTGTCTTCGGTGCCAGTGA
GGCGATCCGACATGATCGGGAGCCAGGATTCATGTCCGACTTCTTCCGAGCGTTCAACAAAATCCTGGCACAACGCCAGCGTGCTACAATGGCCTATCGG
CCTCAGGCAAACGGGGCAGCCGAACGCATGGTGCAAACGTTAACTCGCGTATTGAAGATGTATGTACAGGATCTAGACCAGCGAGAGTGGGATGAATATG
CAGAACGACGGACGTTCGCGATCAACACTGCCCAAGACCGGATCCGAGGTGACACCCCATTCTACCTGGTACACGGATGGGATCCAAGATCTACGTTGGA
GGCCGCGATCCCAGTCGGCAGCACTCGACGATAGGACCAAGATCCACGAAGATGGCGTTACCAGATCCAAAGGAATTACCAGCAGGCACGAGGACTGGTT
AATGAAAAGTTGCGCGAAGCCATCTCCGATCAGGCGGATCAACACAACGAGAGAGCTCAACTCCATCAGATCGAGGCGGGATTTCAAGTCTGGTTTTACG
TAGATAGGGTCAAGGAAGGGTACGCACGTAAGCTGGCGCACCTGTGGAACGGCCCGTTCTGAGTGATCGATCAGATCAATTACGTCGCCATGAAGTTGGA
GATCGCAGGGCCCGGATATCATCTATTTCCTATAGTGCACGTTTCTAAGCTCAAGCTGGTCAAAGCGTTTCCAGATCGGCCGAAGATCAGACTCACCatc
gaagacggagatcggTTAGATCTCGATGAAGCTCTGCTACCAGAGGACAGCTCTATCCATGATCTAGAAGATGATGAATACGATGTGGAGGAAATCATCG
ATATGAGGACCGGTCGAAAGACCAGATATGACCGGATCCTCCGAGAGTTCTTGGTGTGATGGCGGAGATATGAAGATCAGAGCTGGGTGGACGAAGCCGA
TCTTAACTGTGGTGCCTTATTACATGAAAGTTTACGAGATCGCATCAGCCACCACAGGTTCGGTGTAATGCAGTCTCACGAGGAGTAGTGAGGCTGCGAC
CGACCGGGATGAGTTGGTCGCCCAGGTGGAAGAGTGAAGAAGAATCTGCGAGGAGGTCACAGATCGGAGGAAAGGTTTTTACATATATAGATTTAGACTC
AACAATGGAGACCAGATCTTCCAACCCAGATCCGAACGTACAAGAAAAGATGGCAAGGAGAAGCAAATCGAGATATTAAGAGAAGCTATCGAGTTACGCA
ACGGTCACATTACTAGGGTCAGGATCAGGAGGCGGGCGAAACCTAGCGACCGATCCaggcagaagaagatcctCACGGCTGGGCCGCCCCGGCGCTCTGA
GATACGTTGAAGAACTTACCGGGCAAGCGCGAGATCTGGTGAGAAGGGTGAAGATCTGGAGTGTCACAGAAGTGATTACGCGACGGATCGACATCGTTGC
ATTCGTCCAGAGCCTCCAAGAGATCTGTGGGTTCGACCTGGTTCAGAGTCGGGTCCGCCAAGTTGGCCGACGGCGAGGCAATACCGGGGTACCACATCAC
CGACTCCGTCCGACGGGGAAAGTAAAGGGTGAATGGATCCAACAACACATCCAAATCACACCAATTCTCCCGCATGGCGGTGATCAAACCCACGCCAAGA
GCTTCCACGCGCTCCCCGCATGGGAACGACGGGTTTTGCGCTCTTTCCAGAATTGGAGAAACCACGGATCCGAGTCTCGTAGCGCAGTGGGGATGGGGAA
GGAGTGGGTGGATTCCCAAAAGGCTTGTAGAAGACCCACTTTCAATGTCTGGTACT