Description :
From Genome Similarity Track
Location :
Scaffold_1544:59- 4355
Sequence
4296 bases(100 bases per row)
AGGCTTGGTATCCATATAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTT
AGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCCCGTGGACGCGTGCACCGCGTTGCTGAGCGCAAACTCAACA
ACTGGGGGCTGCGTCGACCACGTACGTGGAGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGGTTAACGCGCTCTGTTAGGCCGTCGGTCT
GCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAGCGCGGCAGCGAACCGCGGGTCTCGGTCCGAGACAAT
CGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAATCGTGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGCAAGATGTACCATC
TTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGCCTCATCGACTTCCAACAATCAG
CCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTA
CATGTGGGTCCACCAGAAGGACTGAGAGACCGAGAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCG
AACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCC
GTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCAT
GCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCC
GGCTTGTACTCGACGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCGCCCTCAAGGACG
CGTGGTCTGTGTAGATCACAAAGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGG
GTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTACAGCAATGCACACCCGATGGCGTAA
TCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCT
GGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAAGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTT
GGCCAAACCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTG
CTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGAC
CGGAGGTGTCCTAGATGCACCTCCATTGGCCGTCTTGCCTTCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAA
GGGCGGAAAAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAAGCCTGCGGCATGACGAGCCACTCCCCAAGGCATGCCGCTTGGAGTG
CTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTCGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGT
TCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTT
ACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGT
TCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTG
GGTGTTTATTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAATCCCAGCGCGCCTGACGCTGCTT
GTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCGATCTCTCCA
GCCTTGAGGTTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTTCAGTATCTCTGCAACCTCTGGCAATGGGTTTAAGTGGACACCAGATGCCTTGA
CGGGTAAACCCGTCTCGCTATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCAGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTC
GATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGAAGCTTTGCTGCCCACGTCTAGGGATGTCGTC
GCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCCGTTAAGGTCTGGGCGACCG
CGTGTGGCACTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGCTACCCACTCTGAA
CACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGC
GCGGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGGCAGCCTCTCGCGGGGCGC
TCTCGGTTCTGAACAGAGGTGGGAACATGACTCCACCAATGTCTTCTGTTCGGACTGCGCAGGGCGGCTGGCACCGATTTGCCTTGCCTCGCCAGTCGAT
CCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAAC
TTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCTCTTGCTTTCTCGCAAAGCTT
CGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCCGACGCCCCAGAATCGATCAAGATTCTAAAGGGATGATCATATCCCC
GTACACATCCGTGTACTACGAGCATCCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCTCCGTGGTACGCGCCACCCGC
GCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCGGCGTTCCCCTGCCCCCGGGATCCTGGCTTCTGCCAGCGAC
CCTTGAGGACGGGCTTAGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACGGTCGCGCTTGAAGTGGCCCATCTTCCCGCAGCCGAAGCAGCGGATGTC
ACGCTGTTCGGCGGACCCGAGTTCCATGGGAGCTGGTCCGTTGGGGCTTGTTCGACCGGGGGCCGACATGGAACTCCCAGGCCCCGCTGAGGCCGGCGTG
CGCGCCTGGCGATGGTTGTACTCTTCAAGAAGACCCACTTGTATTGCCTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGCGCTGGGCCCA
CTCGAAGGCCGTCCATGAGCACAGTCATCTTGATATGTTCGTTGAGTGGGTTTCCCACTAGGGACGCCGTAAGCTCCAAGTATTTCTTGGATGTAC