Description :
From Genome Similarity Track
Location :
Scaffold_71:59- 4059
Transcript NameFunction/comments
Phyta_totarag2863hypothetical protein
Phyta_totarag2864hypothetical protein PHYSODRAFT_315332

Sequence
4000 bases(100 bases per row)
GTGATTTGCGATGCGTTATCACGGATGCCCGATGATTAGTTGGCACACATGAGTCGGGCCACGATAAATCAATATGATCGGATTGGCATGGTGTCTCGGG
GCGATGAAAGTCTTGCGCCCCTTCTTGCGGTTATTAGCAGCTGGTAAGGATGCCACGGCCTATTGGCTGTCGCCTCGACAACGGGAACGCCTCCACCGCT
ACGAGTGGACTGGCAGCCTACTCCCCTATTGCGTGGATCCCAGCGATCCTCCTCGAGTAATCGTTCCGAATGACGAGGGCCTGAAGTACGATATATTCCT
GGAAGCGCACGCTACGTCATTCAGCGGCTAACTGGGCCGCGAGAAGACCTCCAGTCGGCCTCTCAGACGTTTTGGTGGACCCACATGTACGAATAGGTCG
CCAAGTACGTGAAGCCAAGTGAAACATGTCAGCGTGTGAAGCCTGCGGGCCACGCTTCAGCTCCCCGGTGGACTGTTGGAAGTCGATGAGTCTCGACTCG
TCTTCGGCTTGCCGGTCGATGACCAGGGCAACACCGGCATTTTGGTATTTGTGTGTCGTTTGAGCAATCTGGTACATCTCGCTCCGGTTCCCCACGCGGT
AACCGGGGAATAAGCCACACAGCTGTTCCTTGATAGCGTGTTTCGCTATCATGGTCTCCAGAGGTCATCGTGTCCGATCGAGACTCGCGGTATACCGCTG
CGTTCTGGAGAACGCCGTTTCAGTTGTTAGGAACCAGGTTGCTCATGTAAATCGCTGACCATCCCCAGACGGATGGCCAAACGGAGCGCGTTAACCACGT
GCTCGAGGACACGTTGCGTAGTGTCTGAGCTTCGGCACCAAGCACGTGGTCCGGCCGGTTGCCATGGTTGGGTTCTCACTCAATAGTGCGGTGCACGCGT
CGACGGGATTCACGCCATTCTACCTAAACGGGTTACGTCACCCTAGGGTGCCGCTCGGGGCACCGAGGCTCCGGTCTTAAGTGGAGGTGAGGCTCGGAAA
GCACTTTCCTCCCAGGTCTCGCAAGTGAGACCAAAATTACCGCTGAAGCAGTTGTCAGAGTTTTTTTATTACGAGCTGAATGTAACCACCCAGGCTATAG
GTGCAATGGCATCAGCCCAACATAAATAAAAGGAGTATTCAGACAATCATGAAAGAGGAAACTTAAAACGTGTTTAATGTGGGTGGGTTAGTCTTAGTAG
ACACCAGCAACTTACTACTGAACAGGTTAGTTCCGTAGGGAGCAACAAGCCACATCATCCCTTCGCGGCCCTGAGTAGACACGGCGCTGCCTACACCATC
GACTTGCTTAAGTCGATGACGGCCCACCCGACATTTTATGTGAATCGTCTGAAGCGGTACTACGACCCGCAAGGTCAGCCTGGCTCGCTGGGAGCGGAGG
ACGGCCACGAGGAGGTTAGTGTACCGCCTCAAAACGAGACTGGGTTTCAGATGCAGGGCGCCCCGCAGAAGCGGTGAGAGGTGGCCCTCGGTAAGCAGGC
TGATAACGCTCCTAGTCGTAGAGCGAACGTAGGACGACGGGGTAGGTGGAGGTGGGCGAACTTTTAGCCGTAGTCATACGGCTCAAAGTACTTATACGAC
TGCGACTCCCGATGATGCACGCGGTCCTCAAGGGCGCGAACCCAACGATGCAGGTCTCCCACGTCGGAGGACTGGGCACGGCAATCGACCCGGTCATGGA
GAGCGTAAGTCTCCCAGCCCAGCGCAGCCACGCCCCGACGAAGGGTGTCAAGGGCGCCAGGCTTGCCAAACTGAGCAGTAGCCCGCCCACCAGGGCCAAG
ACCAGGGCTATCTCGAGCACCAACAATCGTTCACGGAGGAGCCGGATGTCCTTCGGCTTCAGGGCCACAACCTGGTTCAGAGGCTCAGCCAAAGGTCTCG
GAGCCTCTCTCCTCACAGGGGGCTCGTACGAGTAGTCGTGAGTGGGCACCGCCTGCCTTCTCGACCGGAATGGAGAACTCCACTACCATATATATAGATT
TCCCGTAAGCGGTGCGCTCGTGGGCAACGCCAGCTCTTGGCGAAGTGGCGTGGGCCTCATGTCACAGAACGCGCGGGAGCCGATTGAACGGCTCCAGGTT
GACTGCTTGAAGGCTGTCGCAATCTGGGAACAgaagcgacagcagcttcgtaAGTAGTTCACGGCTTAGCCGCTTTCCGGCGCACGGGTACTGAGGTAAA
CGTACCGTACCCACGCTCGGTATGAGCGCCGGGCTGAGCATGACGCTCCAGTCCTCCCATCTCGGAGTAAAGCTGCCGCTTACTCACATGATAGGTGAGC
GTAATGTGGAGGTCGCGCTaaacgaagatgaaggacaGCGAGTGGTCCTcctggagctcgtgaagcTCCTTGGCAGTGTAGCCCCGCAGTGAGACCAACT
ACCAGAACAGTGCTTCTGCCTGGATCTCCGTAGTAGTGCTCTCGGGTAGGATCCAGGGGTAATCCCACACATAGGGTAGACAACCTTTGTTCTCCATGAA
GACTGGTGAATTACTTGAGCAGAATTGTATGGGGAGCTAGGAGTACGAAACAATCGGCCTCGAGGTTGCTCGAGAACAGAGGTTTGTTCTTAACCAGGCG
CACTCGTAGGCGCCCTTTGGAGGCCCTACCTCCTACGAGGTGGCGTGGGGCCTCAATCTTCTCCTAGAATAATGGAGCGCCAGAGCTCGCATCGGCCGGA
TAATAGCCCCAGAGGTAGGCAGATCCTCCGCTCACTGGTTGTGAGCTGATTGTCGGTAGCGATGTGGTGGCGGATGCCATGCGCGTGCGACTGATCAGCT
TGATAttcctcttgctgctcatCGAGATCGTTGGAGAGGTCAAGGGCCTCGTGAATAGCCCCATCTTCGGACTCCGACGACTGGAACAAGTCGTTGAACA
AGGTcctgcccccccccccccgtgtCGTGGTGGGGTGACTGTGAAGTGGTAATCTTCTTAGAGCTGACATACTTAGCCAGCTCGTCTGAAGCTACGGCTT
TAGAGCCTGGGACCGTGCACGGCCCTTTGCGAGTGGCAAGTTAATGACAGACAGAGCCGCCGTGGCGGATCCGACCTTGATTGAGGCACTCGCCGTACCG
CCAGGAGGCTTGGTCGCTCTGGCCTCGCCTCCACCTTGGACCGTAACACTAGCCCGGGGCGAACCGTGATGGAAGCTCGACTCGCTCTTGACACCAGCGT
AACTGACGAGTGGGATGTCAAACTCTGGGTCACCCCAAGACCCTTGACTGTTGTCCCGACGGACGAACTCAGTGTTCGGCCGATTATCAGGGGGCACAGA
GGGTGACCTGCTGCACCGGGATCCTGCGCTAGCAGCTGTGGCAGTATTGCCAAGCGATTGAATCGCCGCGGAGGCCACAACGGTGGCTTCCTTCAGAGCT
GAGATCTTGCCATGAAGATTGGCCACAGCAGACTTTGGCTTTGCGGTCTTAGACTTAATGGACGCGTTAGCGCTATGCGATGGTCCCTTGCGGACCATGT
TCTTAGGTCTATGGAGAACCCTGGGAGCGTTTAGCAATATGCCTGGGATTTGTAGCGGCAGCGACGCTTGGCACAAGAGCACTGCCTGTCGATGGGATTC
GACTGTGCGGGTGAAATCTGAGGGCTTAATTTTACTCGCTCTGATTGATCGATAGATCGAGCCTAAATGGGAGAGGGTCACATGAAGAGTGACTCATCAA
TCCTCCGAGGTGTGGTGTGACTTACACCACACCACATCGATGACGTATTGGTAAGGGGTACCACTTACACTGAGAGCCGTCCATTGGTGGCTCATAGATA
AATATATTCGTTTCAATATAGGTAACTTGTAGTTTGTATTGCAGGACAAATTAGAGGTTCCTATAACTATATTCAGTCTTTAAATCTACCTTTCTTGGTA
ACAAGTCCCCCGAGACCAGGGACTCGTGAACAGTTGTTCACTGGGAGTTTGTATACTCTCTATCACACACTTCCTCTGTGCAAGGTGCTGTGTGACACCC