Description :
From Genome Similarity Track
Location :
Scaffold_324:59- 3908
Transcript NameFunction/comments
Physo_125653hypothetical protein
Physo_144915hypothetical protein

Sequence
3849 bases(100 bases per row)
GCTTCACTCAAGCAATCTCGGACATGTGCCTTTACTTCAAGCATGACGGTCCCGACATGGTTGTCGTTGGAGTGTACGTCGACGACCTTCTGGTGACCGC
AACGCGCGAGGAGTTGGTGGGCAAGTTCTTTGAGGACATGGCGGCCCTATCGATAAAGAACCTCGGATATGTGAGCCGATTCCTTGGGATGCGTGTTCGC
TATGATGATCACCATGGGTACGAACTCGACCAAGAGGTAGCCATTGACGAACTACTGCGCGAATTCGGCATGGAGAATGCGCACGGAGTGCGAACACCGA
TCGGAGAAGAGTGCAACGACAAACCAGCACTTCAGGAGGAGTTACTCCCCGCTGTGGACAAAAGTGGGGGCCTACGCTCCGGCGATTTCAGTCTTTGGTC
GGTAGCCTGCTGTGGCTTGCACGCTGTACAAGACCGGACATCGCTTTCGCGGTCCACAAAGCCACACGTCAGACGCATCAACCTCGTCTGGCGGACTGGA
AGCTATGTAAGCGTGTGCTTCGCTACCTAAGTGGCTCAAAGAGCGTCAAACTGCGAATGAAAGGCTGCAATCCTGGCGCGGCGCTGCGACTCGAAGGATT
TAGTGATGCAGACTTCGCGGCGGACAAAACCGACCGCAAGAGTGTCACGGGAGGCGTCGTGCTACTGGACGGGATGCCGATTCTGTGGGTGTGTAAGAAA
CAAGGTGGTGTCGCGCTTTCGACTATGGAAGCAGAATTTACGGCTGAGTCGCACGTTTGCCGTGAATTGCTGGGTTTCCGCCAGCTACTGCTGGAGATTC
GCTTGCCGGTGCTGGAGCCGATGCCGCTCATGGTTGATAATCGAGCGGCGATAAAGCAGCTTCGAAGTGAGTCGACGTCGGCCAGCGCAAAGCACATTGA
CATTTGCATCAAGTTCGTGTACTCATACACTCACCAAGGAGTTATCGAGCCTGTCTACGTGGAGTCGCGACTTCAGCTAGCTGATTTGCTGACGAAGACA
TTGTCGGCGCCGCGTCTCAGCGAACTCCGCGACTTACTGCATTTGAGTGATCCCAAGAAGTCCAGGTACGGCGATGCTGCCGAGGAGGAGTGTTAGAAAT
GGTGACTTGGGTTGCAGGTCGAACTGCAAGTTGCAGTCGAGCTGCGGGTTGCTGCAAGTTGTAGGCGAGCTACAAGTTGCCAGCGAGCTGCAAGTTGCAG
CAGACGGGAGCTGGAAGGTGATCTGCGCTTTGCTTGTGGCGGTAGCATTGCCACCTGCATCTATTTGTATTTGAGAGACTGGAGATAGCGCAGGAGAGAC
CTAGGAGACGTAGGAAGCAAGGGCTACGAAGGGTATGCGCTAAACGTTCAATCTCAATCACTTCTGCTTTTACTTTCAAGCCCACAAGCGTCCTACACCG
TCGCGACACCTTCGTTCAGTCGACGCACCAAGAACAAGTCCAGTGTGTTCACACAGCGGCATCGATCCGAACCGGATGAGACCAAGATCCCCCAAGATCC
ACAGGCGGCACCGAATGAGCCGCAGATCCAAGGGAGAGGACCAGTTTCAAGACGAAGAGACGGTGTACCCAGATACCTCCGTCATCATCTGATGAGTGTA
CCCGAACAAGTGTCGCCGTCAACAAGTCTCCTCATACCGAAACCAAGACAAGCATACTGAAGAACTGCCAAGAAGCACAAGCATACTCAAGACAAGCGAA
GCATAGTTAAACCTACATTATAGTCAGCGAAGTGATAGAAGATAGCTAGCCAGACGCAAGATCTAAACAGAAACCAATTTGCCGAAGAACACGCGGACGA
CTCTGTGCTCGGGGCAGAAGTAGCACCCCGACTTTGACCTCTTTAGAGCCCTCCAGGAGACTGCCTGCGCGCGGTCTAAGCCAGTTTAGGGACGCTTCCA
AGGCCTCACTGGTGTAGCGAGCACTGGTGTAGTGGGGACTCAAAGGTACCAAGGCAAAGTCGGCAGTGACTGGGGTGTCGCACCCCGGAGTGACCTGTGA
GAGCTTTATTTTCTATTTGCGTGCTCTAACCGGGCATCCATTTCATATTCCCTACTGTGTGTCTTTGGTGGTTGAGGTAGTCACACACCCCCAGACCGAA
TTGATTGACTACTATGTGATAGGACTGAATTATATTTTGTATTGTTCCCTCATTCTGTGAGGGTGGTGCGCGTAAGTGAGTGTGCATCCAGGGCTGGCCA
GTGCCTTGGGTGACGGCTCCGAAGTTGACTGGTGTATAGACCCCCCACCCAAGGGTCTCAAAGAATAAGTGGTGGCTGTATATTGTGTGACGTTTAGCTC
GGCATTGTATTTCTGTGTGTTGGTTATTCTGAATTACGGATCTGACTGTGGTCCCTTTCATTCGGTCTGACCTTCTGTTCATTCGGTGTGGTTTATCCAA
GGAAGACACCCAGCAGACTTTATTCTGTATCACAACAACTCAACTCGGTGAAGTCCGGCCCACCAAAGGTAAACGATACCTATAGGGGTTGACACAAGGA
CACACGCCAAACCCCGGACCGCATTAATGCGATTCGGTGCGTCCAAGCGGTTCCAGGCCCGGGTCATTCAGTGTCCCGTGGGGTGCTTATCGCGTGGACA
ATCTCTGGTACTCCGAACCCGAATTTATTCGGTCCGGCATAGTGCGCTATACACCCTGGACGATAAAGGGTTCACCCGCCTCGCGTCAGCTGGTGAGCGT
GCCCGGATTTGGTTGCCTAGGGTTTCACCGCGAGTTGTTTGTATTGATTTGGTCTTAAGGGGTGTTTCTACTGACTACCTGGACTAACGGTTTGGTTATG
ACTGGAAGGAAGGAAGCACGTGAAGGTGGACGCGGAGGCGGACGCGGTGAAGCGTCGCGTCAGTCGCGTCGAGGACAAGGGCTGCCGCCGGAGGAGCACA
AGGCCCTGGACGACGTTGTCCGGGAGGCTCGGAAGGCTGGTGCTGAGAAGCGCAAGGCGGCCCTGGAAGAGAAGAAGAAGGCGTCGGCGGCCGTTCAAGA
TCAAGCGGCCCCGGAGTCCTCCGTTCTGGATGCGCACCAAGCAAACCAGGATGAGGCTCCGGAGGCGGACTCGACCGAGTCTGTGCCGTCGGCACCGAAT
GTGTCCCAGACCCGGCGACGGGACTGGATGAGGGTGAGTCCGCAGGATGATGAACCCGCCCAGGCGTCTGTGGGAGGCGCCGATGAGGTTGAACCCCCGG
CTGAGGATCGAGTTTCGGACTCTCCCCAGCCGGATGACGAAGTCGAGATTCTGGATGAAGCCCCGACGACCAAGCACGAAGGCCTGCTGTCGACTGTCCA
AGAAGACGGCGTACTGAACGACGAAGCCGAGACCCGGTCTGCCCCTGCGCCATCCGGTCCGGCCGCGACTGCCCAAGCACCTGCGCTCAAGATTGAAGCC
CAATCCAGTCCGGCGCCCTCGGATTCGCGAGGACCCGACGAGACCAAGGCCCAAGTGAGCGAGGCTCAGACTCAGGCGTACGTGGCCGAGCAAGTGCGCC
GCTGGGAGCAGCATCGTGAAAGCGCCGTGGTCCCGCTCAAGGTGGAGTATGCCTGGCCCGAGCCGGCACCCGACTTCACCGAATGGTGGGCCGCCGCGCT
GGCGACGTCGAAGTACCTGTCGGACCGAATGGCGATGGCAAGTCAAGACGCTGCATGGATCGCGGAGCTTGATTCGGTACGGCTTGAGCTGTGTCTGGCC
CAGGATGTCACGGGTATCGTGATTCCGCCGAGCCTTCTCTCGCCGCGCGAGTGCGTTGCGCTCATCCAGTCTCTCCTCTTCGCTGCCGGTGTCAGGTTTC
ACAACCTGATCCCGATGTGGTTCCAGTCCAAGTCCTCCAGAGTCACACC