Description :
From Genome Similarity Track
Location :
Scaffold_2628:59- 2808
Sequence
2749 bases(100 bases per row)
TCACGTAGTATTATCGACCTGGAATCCTAGGGTCATGCTACCTTGGTTCTAGCGATGTCTTGTTCACAAATGAATAAATGTATGTATCTAGAACGCTCGG
CTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGG
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGGAGCAATGATCCCCGGGATGGCCTTTCT
TGCCACACTTCTCACAGACCAGGTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAG
ATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAG
ACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCG
TAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTC
GTCTGCGTCGGGAAGTCGTATCAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTGGCGCGTAGACCGGCCCACATTTAGTCGGATGTAGCTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTA
GTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGA
TACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTTAGCATCCGACGCTTGATCTCCCATGAGGGCCGACTTGACTTTGCTGA
TCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACC
TGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGAC
TCCATCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTT
CAAAGTGCCGTTGCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTG
ATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACG
TTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTG
ACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGACCCATAGTGCGCGACCTTTCTCCGGTGATGGA
CTTAACTCTGGCAAAGAGGTACGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACT
CCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTCGGATCTTCGATCTGTCGTGGATT
CAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCA
GCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTA
GGTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGC
AGGGGTCCCCGAGGGGACCTGGCGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTC
CATCGATCCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTAAGCATCTTCT
TGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGAACACGCGCACCATTGTGGTGTAGAGGGATCAGCAAAATCTGCGAGATTGCTGGATCTAAC
TTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGA
TCTTGCTCTCTCGGTAACTTCCGAAGCGTTCAAGTGGTGAAGCTTGAGT