Description :
From Genome Similarity Track
Location :
Scaffold_3411:59- 1358
Sequence
1299 bases(100 bases per row)
AAAACAAAATTACGCTATCACAGAGATTCCCTGTTCTCTACAGCTAAATTCCCGAGTCGATATAGCACGAGTGGTATCTGCCGGCGTCCCATTCACTTAT
ACCACGGGCGTTTTTGAGGCACTGGCAAAGGCCGCCAGGGCAAAGGTGGCGAAGAGCGGAGCGTCATTGGGCTGGGCGTCTGTTTTTCTCCTGGTAGCGA
TGCGCAGTGACAAAGCCACTTCGGATATCTAAGCGATTCCAGCGAGGCCTTAGAAGCATCCTCCCCGAGATAGTTAAGCTCCCCTACTCCGAAGAATTCC
CTTCTCACGTGTCTTTGAATAGACGCGCCACTTTCATGACGAAATCTGTCGCAAATGCAGAATCAACACGACGGTCATCGTATTTTTTTGACGTTGTCTC
TGGAGTTCTACGCAACGGATTGCTGAACGACGCCGTGATTGATTTCGGAATCAGAACGATTGCAGAAAGTGTGGACGGCTGCATCGCATTTTCTTCGTTG
ACATTGGCTATTGGGTGGCCTGAACCACCAAGACAGCGGTTATCAGAGACACCTTTTGTGGTTATGCCCATAAATTTAAGTTTGAACCACTGGGGGGGTC
ATTATTGTGGAGATCGCGTTTCTGTTAACGTATACGCTCCTCTAGCTCAACATAGTGCACTCAGTCTAATTCATCAATTCACTTTCCGATTCCCCTCCAC
GACAACAGTTTCCGACAATACATGTACTGAAGGTGTATTTCTATGAGCCGCTACACCAGGAGTGCTACTGAAAAGAGCTGGAAGATGATAGTAATTTCAT
TTGCTGCCATAACTAGAGAAATGGCACAGTGCCTGCGGTGCAAAAGAGCTTTTTCCTAAGGAAATTATCGCGAAGTGGATAGACAAGCCCTCACAACCTG
ATTTAAAAAGCTGTGGAGTAATGGTCCTGGGTATTGTGTACGCACACTTGCGCAACACCCATCGATTTGCAAATTATCGGGTGACAGAAGCTTATGTAAG
CGTGATGCCGCTTAAGACTAGCCTGGTTGCTGCTGTGCACGACGAAGCTGGTGCCACACAGTGAGAAAAAATTGACGGAAAAGCAGAAGACGGACCAAGA
GGTTAGTAAGATGCTGCTTCCACAATAATCTTGTAGCCATTCGTGGTTTTGTGATTATCGGGAACGCCTCCTTCTCGATTATAGGCCAACGAAGTTGAGC
GTCGCGAAAAACACTACCTTTACATATAACCAGCGAGTGATCTTGTTCATCGACTGGTCGGGAACCGTCCCAATTACGGACTGCTGTCACGACAATGCT