Description :
From Genome Similarity Track
Location :
Scaffold_25:589604- 591392
Sequence
1788 bases(100 bases per row)
CTTTTTCAACCTCTAAAACTTAGATATTTGCATGACAACCACATCAAGAACAAGCTCATCAACAATTTATTGAAAAATAAGAAAAACAAACAATTTTGAT
AGGTTTAATTGTGAATCAGTTATTATCTTGTCAAAGTAAAGTCATTTCCTTACAAATTACAACTATTAATTGTAACATTACTCCAGAGTACGTAGTACTG
TACTACCTAGTCATCTAAAAACTTCCAACTGGCCAAATAACGTACAATTAATGTAGTTAAGGTAATCCATCAATATCGCGAACGCATTTTGTGCACTAAA
ATATCAAATGTTTGAAGCACTCCACCACAAAAAGTCCCTCGAATAAAAAAAAACTAAAGGTAGCGTTGGAAAATATAAATCCAGCTGCATTTTTTAGTGC
TAAGAAGTGCCTGAAATATCCCAATAATCGATTTGTATTTTCAAATTATAACGTAACGTTAAGAATTGGTGAAACTTTTTTGGCTTTGTATTTCGCGAAC
GGTCGTAATATCTTAGTTTTGTATGTATGGAATATTAATTTACAAAATAATATACCTGGGTGTCGTGACGCGTTTTAATTTATACATGAACTCAATTATA
CATTAAATTTGAAGGCATTATAATAAGATACAAGTTGAAATTTGTATTCGACAACATAAAAATGAACATAGTTTTGAACTTCAAGGTGGTATCCTGATCC
TTTGGCTGAATATAATCATATCCAATGAAAACTCGTCATTACAGAATGAAGCCATTGGATTGGATATAATGACAACCGTTCGCGATATTGATGGCGTTCG
CGATATTGATGGATTACCTTAAACCCAAAAATCAAATACGTTAAATACCGATTTCATGCGTTTTATCACTACAGTCGGAGGTTAAAGGTCCCAACTGCCT
CCGGATATTATACACGGATAAGAGTTGTATACAAAAATCAAGATACATCTCAGCTTCACCCCTATGATACCCAAGCAAGCGCCCATGTAAAATACTGTAC
CGCTATATTAAATATCTATTTCTGGACCAATTCATCACCAAATTTGAATCTGATAAGGAGAATTTCTTCACCACATTGAGATCTGTCGATTCTACGTCTC
AATTTGCTGAAATTTTGGTAATGAATACGAAATAGAAGAAAATTTTATGAAAAGTTGGTAGTATTTAGGTGACGTGCATCATACTATCGTTAGTACTGTA
CAGTAACTTCCACTTGTGGCTTCATCTGCAAAGGCAATCAAACATATCAGCTTGTGTAGCCTTCTTCAAATTGTAGGAACACCTTGCATGCGTATGAGCG
TCGCTTAACATTGCTATTACCGGTAATAGTATTGTTTATTCCCACTCTACGTGAAAGAACTGTTTCTGCCCTATCATAGGCCAACTATGTAAGCAGTCCG
TTCATCATCACTTTTGGTTTTTGTTCGTGACAATTAGGGGGAGTCAAAATAGGAATTTTGTTTATGAAACCGACGATGCGTTGTGAAACTCAAAGTGTTG
GTTTAGTTGTTGAGGTTGCTGGCTTCGAATTCGAGGGGAGTTCCTCGTTTGAACATACAAATAAAACCGGTGATGTTCTATATTAGTATTTCAAATGTAA
TTAGTTTGAGTCAAGTACTATATGGTATACGAGGAGTCATATCGACTTGTTTGCAAGTCTCCAATTTTATCTCCCCACCATTACACCCCCATTGTCGCCC
ACTAAGTTTCACAAGATTGGTACAGGGGTGTCGAAGCGTAAGCCCCGGCGTGAGATTAAGTTAACTACCGGTGCTAAAATAACATTGT