Description :
From Genome Similarity Track
Location :
contig_93:58955- 61033
Transcript NameFunction/comments
g12689.t1RAW29677.1 putative pre-mRNA-splicing factor ATP-dependent RNA helicase [Phytophthora cactorum
g12690.t1POM61894.1 hypothetical protein PHPALM_29023 [Phytophthora palmivora var. palmivora

Sequence
2078 bases(100 bases per row)
GCCGCCAAGCTGCATGCAGACGGTGTCTACCGTACGTTGCGGGACCAGCGACCCGTGCAACTGCACCCAACCTCCGTGTACTATCACATGGGCACGCTCC
CCGACTGGATCATGTTCCACCAGAGCGTGCTCACCACGGAGGAGTTTGTGCGCGATGTGTCGAGGATCGACCCTCGTTGGCTTGTGGACCTCGCACCAGA
TTTCTACCGCGCGAAGGAGGTCAGCGGTGCAATATCAGGCAGTTCCGGTGCACTTGGCTTGCCGTCCACATCGTCAACGATGCCCAAGAGCAAGAAACAA
AAGACGAATCTGTCAGAAGCCGACACGCCGCCTCGACGAGCAGCTACCGGCGGTGATGGTCGCATCCTGTTCGGAAACCGACGCGCTCCGCGCAGGACAC
GAAATCTAAACTGCCCGTGCACATCGGCAAGAGCAAGGGTGGGTTGCGGTCGCAGTTCTAGTTGTCCACCATGGATGCCATCAATGAAATATGGAGAACA
CGCGATTTCTTCCCGTCACGAAAACGTTCATTACTATCGATACAGCTACTGTGAGTTGTACAGGCTCGCTACTGATGCGCCCGCTCTCCGAATTGGCTGT
CGGAACCTGCGCGCAGTCGTCGAACTTCCAGTACTCGCATCTTCCTCTGTCGTCGCTCAATGGACTCTCGTTGGCGGTCAAACACTGGCACGCTGTAATC
CTGCAGCGACACGTACGACGAGCCTCGCTGCGAAATCTCGCTGGGAGCGACGCTCAGGAACTCGTCCAGCACCTCGCTGGTCTTGGTGGCCGGGTGGCGA
ATAGCTAGTCGCAGGATCTCTTGGAACCGCTTCTTGCGCTGCTCCACCAGCCGCACGTCGTGGCGCTTAAGGTAACTCCAGACGCCTGCGCTGGGCAAGG
CCGGCAACGTGACTGTTCTGTAGTTGGTATTGGACACTGGTGGGGCCTTGGTGAGCCGCGGCACTGTGAGGGCTCAGTGGGATGTGGTTCTCCGGGCCGT
CGGGGGACGTCGCTATGCACGCTTCCAATTGGACGCGGGACGCCTGATACTCGGCCAGCAGGCGACTCAGTTCGCTGTGGAGGTGCTTGAAGGCGCGGAA
GCGGCGCCGGATCGTGTACGTGGAGAGAAGCCCGTCAGGGCCTTTGATGTCCACGTGGTACATGACGACGCCCTGGTTGTTGATCGAGTGGTTGTTCACC
TCAACGGTCACGCCCTGGTACGGGTCCATGAGGCCCGTGGGTGTGAGTAGCTGGCTGTGCGACGCGTCATGGTCCGCATCGACGCTCCAGAAGTTGAGCA
CGTCGAAGCCGCTGGCCTCGCTCGTGTAGCTGTCGCGGATGCCGAACGGGTCATTGAAGCCGGTATACGGCTTGTCCAGCGCTGCGAGGCTGCTGCGGTT
GGCGCTGGGCGGCAGCTGGAACGACTCGTCGAAGTGCTCGGGCAGCGCCGACTCGCTAAAGCGAAGGCTGTGGGGGGCTACGACGCGCATGAGGTCTGAG
TCTGATTCGGCACTCACTTCAGGGTGAGACTTGTTCTGTAGGGCGCAAAATGCGGAATGAGGAGGGTTTCAAACTGGCGGCTGGTATGAAATACGCGGTC
GAAGCTGCTCGCAAATCGACAGGTGAGTGTCGGAAAACAAGTTGCTCCAGTTAGCAACGCTGCAGCGACGACGTACCGAGTAGTTGTCGCGTTAGGCAAC
TGGGAGACAACCCTCACTTAGGGCAATGATAACGATATTAGACGACTGCGAAGCGAGTCGAAGGTCGAGGCCGTTCGTTTGGAGAATGATCAACTGGAGA
ATGATCAACTCTGGGTTGCTGGTTATTTTGCTGGGGCATCGCAATGCGGTTTCTCTTCTCCGAAACGACGGCGCGCGTTGGAGGAATTAATCTATTCAAG
TAGATCGAAGCCATTTCTTTAAACGGAAGTAGATTCCAGTGACTACTTCAGCAAAACCAGGGCGAAGTCAAGCATTCCGAATCCATCATGCAGCACTGGC
CCTGTAGCGCTAGGATCAAGAGGCAGCCCGGTAGCTTGATTAGAAACATGCCTCTCATCCATGCTGCATCGCGCGCCT