Description :
From Genome Similarity Track
Location :
scaffold_9:589544- 591945
Sequence
2401 bases(100 bases per row)
TCCTTCCCCGCTTATATAAAGGTACACTacccatcgcacaaagcggtaATTGCGGGTGTCGCAAGTCATAGATGAAAATTGGCTTAAATTTGGCGAATAG
ATATATTGAATAAATGGTAGTGCCAAACTCATTCCGCGAGTTTTCCGCACAGAAACTTCTCAACATATCACCGATCACTCGGTTGGTATGCTTTGTTTGC
CCATCGGTCTCCGGGTAGACTGCTGTGGACATATCCAAGCGAGTGCTTAGGAATTGGATTTTTTCAAAACGCCACTCGTGAATCGTGATTCACGAGCAGa
gacgatggcgtctggtAACCCATTATTGCGAAACACATGATGAATTAACCATCCATCCAAACATTCGGCATCGATGAATTCACTCGATGAATTCACTACA
CTGAGCGATGCGAACCATCTAGCTGAGTCTGTCAACATAGTCGAGCAACACATTGTGGTCGTCGGCATTTTAGTGGAAGCCGAAAATAGAGCCGAGACCG
GTTGACTTCCAACAGTCAGTAGGAAAGTTGAAGATTGTGCAGTGGCAGTTGCGTGAGCCTTGTGCTCTTCACGCGCTGacagacatcgcatgtcttcacg
tatcgTACCACCCACTTGTACACCAAAATTGGGCACTGAGAGATCGGAATGCCTTCTCACGGCCAAAGTGACCGACCAATGGCGTATAATGCGCCTCGTA
CACTCCAAATCATCGTTGTGggaaaccacaatttgtggctcGTCATAACGTGCAACTTCATTATGAAGGAGACCATCCTTCCACGCATAGCGATGCAACC
TTGATCTCAAGCAACCAGGAAGCCTGTCATGGTATTTCATATCACTCAATAACAAAGCTTTGATGATCGTATCACATGTATTGTGTTCGACTGAGAGCCG
ATCTTTACGGTAAAGATTAATCAAACTTAGTCTTAGTACACATTGCATAGCACCAGGTTGAACATGTCTTGTGTTCATCCGCAAGCAGGTGGTCAAGCAG
AACACATTTTTCTATCGTGTGGTATTGAATAAATTTCAAAGTACTAAAGCATAGCAAATGTTCATCATCAACATACGCTCGGTGTATCATATCctttcga
aaaaaaacaGCTCAGAATCGGGTCAACGCAACAATGCGTCTGCCAGCACGTTCAGTTTACCTGGTTTGTACGCGACCgtgaagttgtattctgcgaagaa
cgacAATTAGCGAGCCATTCGCTGTGACGAGTGAGGTGACTGAACTGCATAACGCAAGCGTGATCCGTGTAGACGACAATCGGAATTGAACCCAAGAGGC
GAACACGACACTTTACCAGTAGAttttttattgcaaaagctcACTGTCATGAAAAGTGTGGTTCTTTTCTGCTAGCctcagctgtcgcgattgaaaTGGC
ACAACACGATCGTGTGCTTCTGAGCCATTTTGCAATAATGCACAACCGATGGAAACGCAGAAGCGTAACGCACTACGCTATGCGGGCTTGTATCATCTAG
TAAAGCAATCCATGGTGCTTCTAATAAGCTGTTCTTGAATCGGGTGAATGTTTCTTCACATGTTGATGACGTATGTACTTCGtcagcaagtttgatagCG
GGTGTACCAGATCCGCGTAATTACGCGAGAAGTGATTCAGGTAATTGGAAAAACTAATCCGTTTCCTCAAATTCCTATAATTTGTAGCACCGACCGCTCC
ATGATTGCTTTGACCTCCTCAGAGTCTGCACGAACACCGTGTTTACAAACATAACAACCGAGAACCGGCACTTCGTAAGCACCAAAAAATACACTTTGAA
AGATTCGCTTACAACCAATGTTCTGCGCGTATATTCCAGCAGCGCACGGAGGTGCACCAAGTGCACTCCTTCGGCACATATTCCACCTTCGTCCTTTAAA
TGGACAAAAATATCTTCAAGGTATTTGAAAAAAGCGTTGCAGTGGTTAAAATAGATGTGAGACCGATCGATTGAGCTTTGCTGGGAGATTGGATAGTCCC
TGTAGCATCACAAACCACTCCCATAGCAGTACTAGCAGCCATCAAAGGAACACCCTCCTTCCTAATTAAGGTTTTGTATTATCATTGGACAAATCAAAAT
CACGGAACTGCTTACAGCCAGACGTTCGGTAAATGATGTCATCCTCACGTTgaatcggcgtttgcgcAGGAACTGTTACATTACTAACTTGTTATAGGCG
TGTACAATACGTCAATTACCATTTGGTTTACGCTTACAAAACGTCAGTGCGCTGTGAAGGGGCTTGTTCCCCCTCATCAACGCTACAGCTTGCTTTTGAG
TAAAGAACTTATCAATTTATTCATTTGTTTCCTCGACAATGGCCACTATCGATTCACTGCAGGCTTTAAACCAGGTTCACGATCAATTTGTTTCGAACCC
C