Description :
From Genome Similarity Track
Location :
Scaffold_79:589527- 591594
Sequence
2067 bases(100 bases per row)
CCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTGCAATCGGTTGTGCTTTACTACAAGCAGACG
CCGAAGGGCGTGAACGCGTGATTGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCATGAAGTAT
GCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCT
CTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCG
CAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTG
CTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCGGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGC
TGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGT
GGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGT
GAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTG
TGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTACCGGACACCAT
TGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCG
AAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAAACTGAACGCGTGAATCGCG
TTGTGGAGGATACCCTCCGAAGCGTATGCGCGGAGGCGCCAAAAGATGAGGTCAGTAGTTGAGCTCAAGCTCTGACCAGTGGCTGCAGCAGCCAGCTCGT
ACGTATGAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACCTCGTAGTGTTAGGGACATGGTCCTGAAGGAAGCAGGTGCTTCGTGTTGTGCTGAAC
AAGGTTCAGGCACAAGCGTCTCGATAGACGCATAGTTGTTTTGAAACAACTTGCTCGATGAGCATGATCCAAATGTGGATGCGCTGTAACAGCGAAAGTG
GTGTCCCGCACGGGGATCGAACCACTGGCCTTTGGCTTGACAGGCCGGAGCTCTACCATTGAGCTACAAGGGCTATGCCCGTACGTCAGTCCGAGAACGG
ACTACTCATGGTATGAGAGACCTGCGCCCGGGTGGATTTGAACCACCGACCTGTGGCTCTCAAAGCCAACGCTCAACCATTGAGCTAAAAGGGTGTTGCC
CTTAAGCTTGTCCAAGCGTGAACAATCGTTCATGGAACGAGAGGGCTGTGCCCTAGTGGGTTTGAACCACCGACCTATCGCTTGTGAAGCGAGTGTTCAA
CCGCTGAGCTGTTGTCGACGACTCGAATGAGTCAAGAGCATTGCTCTAAGCGGTTTGCAGCTCTTGGAGTAGGCGCGGAGCGCGAGCGTAGGTCTGAGAC
CGCTTGAGAGCAAGATGCGCGCTGCGCTTGGAGCATTGGGCCGTGGGCCGACGACGAGAAGTTGGGCATCAACGATGCGTAGGCGTTTCTGAGCTCACGG
AGCTGTACAACGCTGGTGTGAGGTGTAGTAACCTCCGCCGTCTTAACAAGACGTGACCTCGCTGAGG