Description :
From Genome Similarity Track
Location :
Scaffold_1182:5895- 6995
Sequence
1100 bases(100 bases per row)
GCTCTCTATCCTTGGTCAGCACCAGAACTCACGAAATCAGCCAACTTGGGAATCACGATCCGTAAACAGCGAACCAAGGTATTAAAAAACACAACTTCGA
TACAGCCTTCAACCCACTCTCGAAAAAATAAAAAGGAAAAAAAGTGCATCAGCCTGGCAAAGTGCAGCGCTTCAACAAACTGTTTACCAGCTGTGGTCCA
CCCAAGGTATTTTTACAGACTTCCAAAACTGGACAATGTATCGTATCGCTCTTGGAGCTCTCAACTTGCGCCACGATAAATGGCCTGACCACCGTGAATG
TCCTGAACCTACATGTCCTTGCACCACTGAAACGATAGACCACATAGTATGGAGCTGCGATAAAGCACAACATGCTTGGAAAAGATGGCTTGATCAATGG
CTCGGAGTTCCAACTACCTTGACGAAAAGAAAGGCATTACTGGAACACGTTGCGTCAAGGAAGTCACCAACAGCGACAGCAGAATTCCTGTAACGGGGTA
CGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCAGGATATTTGGTACAAGGTACCAAGGT
CATTCAAAACCAACCATTGGTTTTATGACAATGCCTTTCTTTTCGGGGGTTAAGGGGCCGGTTTGTAATTAACCTCCAAATTTAAACTCACCTCAAAAAA
ATATTCCCTTTTAAAATCTACCTTATTTAGGTCCATTCCCCTCTCTTTAATTTAAGAAGGGAACTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTC
GGAAGATAACTTCTCTAGCGCAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCG
AAGTTCGTTGTCATGGATAGGAACGACTTCTCTCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCTCTGC
AGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCTTCATCGCGCATGTGCGGGAGAACCTGCA