Description :
From Genome Similarity Track
Location :
Scaffold_653:5894- 8593
Sequence
2699 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACGGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAATCTCAA
ATATACTTAAGCTTCCTCTTCCTTGTTTGTCTGAGTACTCCTTTTTGTTTATTATGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCT
TGGTATCCATAAAGGATTTCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGCGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAAT
AGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGAAGTGGCGGAAGCCGTTCAAGTAGAACAGCGTGAACCCCGTGGACGCGTGCACCGCGTTG
TTGAGCGCAAACTCAACAACTGGAAGCTGCGACGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCT
CTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATATGCAGATCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTC
GGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGTTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGC
AAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGGCTCATCGAC
TTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCTCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTGACGTACCGGG
CGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTC
CGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCTACCCGATAATAGAGGAGGCCCTCCTGCAACTCA
TATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGT
CCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCGTCCGCAAGCAC
GTTGAGCTTGCCCGGCTTGTACTCGACGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCC
GTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCT
TGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCCCA
CCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGAAGACTGACCTTGATGCTG
TCAAAAGCATCCTGGTGCTCTTGTTTCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACT
TGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAATATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCG
AACGCCCACGTTGCTGACGAAGCAACCGAGAGCTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACG
TCCAACACTCGACGGAGGTGTCTTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGATATGGACGAATATGTCGTCGAAGTACGTCTGTACGA
AGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTAAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCC
GCTTGGAGTGCTAACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCG
GCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTC
CGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGGTTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGAC
CTCGCACTAACCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAACCTCGTGCCGTACGCCTCGATCCGGTGCGGT