Description :
From Genome Similarity Track
Location :
Scaffold_1182:5894- 6941
Sequence
1047 bases(100 bases per row)
CGCTCTCTATCCTTGGTCAGCACCAGAACTCACGAAATCAGCCAACTTGGGAATCACGATCCGTAAACAGCGAACCAAGGTATTAAAAAACACAACTTCG
ATACAGCCTTCAACCCACTCTCGAAAAAATAAAAAGGAAAAAAAGTGCATCAGCCTGGCAAAGTGCAGCGCTTCAACAAACTGTTTACCAGCTGTGGTCC
ACCCAAGGTATTTTTACAGACTTCCAAAACTGGACAATGTATCGTATCGCTCTTGGAGCTCTCAACTTGCGCCACGATAAATGGCCTGACCACCGTGAAT
GTCCTGAACCTACATGTCCTTGCACCACTGAAACGATAGACCACATAGTATGGAGCTGCGATAAAGCACAACATGCTTGGAAAAGATGGCTTGATCAATG
GCTCGGAGTTCCAACTACCTTGACGAAAAGAAAGGCATTACTGGAACACGTTGCGTCAAGGAAGTCACCAACAGCGACAGCAGAATTCCTGTAACGGGGT
ACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCAGGATATTTGGTACAAGGTACCAAGG
TCATTCAAAACCAACCATTGGTTTTATGACAATGCCTTTCTTTTCGGGGGTTAAGGGGCCGGTTTGTAATTAACCTCCAAATTTAAACTCACCTCAAAAA
AATATTCCCTTTTAAAATCTACCTTATTTAGGTCCATTCCCCTCTCTTTAATTTAAGAAGGGAACTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCT
CGGAAGATAACTTCTCTAGCGCAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCC
GAAGTTCGTTGTCATGGATAGGAACGACTTCTCTCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCTCTG
CAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAA