Description :
From Genome Similarity Track
Location :
contig_112:58935- 60306
Transcript NameFunction/comments
g11245.t1hypothetical cleavage-induced protein

Sequence
1371 bases(100 bases per row)
GGGCCAGCCATTCTTCGCTCATATCCCATCGAGCCCAGCCCCGACACAAGTCACTCCCCCAACAGAGCAGGAAACATGGTGCGCGGCAAGAAGATCGGTC
TGGGCGAGTTCCTGGGCGACCAGGCGGCCGCTTACATCCCGGAGGCGGCGCTGCCCTCGGCCCCCGCGCGCGCGCCGACGACGACGACGGAAACAGCTTC
CGCGGCGGCCGTGGCGGCGACCGCTACGGAGACCGCGAGCCGACGCGCAGCGATTCGTCGGACCAGTGGCGCGGAGACCGCAGCGGCGGAGGCGACCGCT
TCGGTGGAGGCCGTGAGGACGGCGGTAACTGGCGCGGAGGAGGCGGTGACCGCTTCGGCGGCCCCTCGCGCTACGACCGCCCGGCGCGCGACGACTTCCA
GGCCGAGGAACGCCCCGCTCACATGCGGCTAAACTTGGCGCGCCGCGGAGAGGGTCCCAGCGGCGACGCGCGACAGCGGCGACAAGTGGTCTGGCGCGTT
CGGCGGTAACAGCGGCGGAAACAGTGGCGGCCGCTTTGGAGACCGCGGCGGTGATCGCTTCGGTGACCGAGGTGGCGACCGGTTCGGAGACCGGGGTGGT
GACCGCTTTGGAGACCGGGGAGGCGACCGGTTTGAGGGCGGTGGTCGCGCGGCCGGACGCTTTGCGCGCGGAGGAGACGACGTGTCGTCCTCCTTCTCGA
ACATGCGCGTGGGCGGGCGACAGGAGCAGGCGGCGCCCGAGCCGCAGATGTCGGACAAGAAGCTGCGCGCCAGCAGAAGCGCGAGGAGCGCAAGAAGAAG
GCAGAGGAGGAGCGTCTGGCAGCTGAGGAGGCCAAGCGCGTCGCGGCGGAGGAGAAGAAGAAGGCGGAGGAAGAGGCGGCTAAGAAGGCCGACGTTGACC
GCGAGACCTTGAAGCAGGTGCTAGCGAGCGGCAAGAAGGGCGAGGCCCTTGCGGACGTGGCCAAGGACGTGTTTGCTAAGAACGGACGCCCTAGCGGCGC
TGTGCTCTTCGAGGCGGTGACTACCGCTGCGGAGGACGTGGCCAAGGCCAGCGCCAACTGGATCGCCTTGCCGGCGTATGGCGAGCTGCTCAAGTTCGGC
ATGGAGGACGCGGACAAGAAGGACCAGATGGAGGCGCTGTACGCGCTGCAGATCTTCCTGAACAAGCACGACTTCCCCAAGGGTGTGTTTGAGAAGTGCT
TCATGGCCCTGTACAGTCTGGACATTATCGACGAGACAGGCTTCTTCGAGTACAAGTACGACGTGGACGGTGACGTCCCCGGTCGAATGAAGGCTATTAT
CCAGACGTCGTCGTGGCTCACGTGGCTCGAGACGCCCGAGGAGGAGAGCGAGGAGGAGGACGAAGAATAGA