Description :
From Genome Similarity Track
Location :
contig_14:589169- 590309
Transcript NameFunction/comments
g3791.t1hypothetical protein

Sequence
1140 bases(100 bases per row)
CGAAGAACAGAAGCATGGGCGTCGCAACGGATGGCACTGAAGCGGCCGAGGTGGCGACGACTCTCCGCCACTTCGGAATCAAGACGTGGATAAGGAAGAT
AACATATGTGAAATTATCCCACGTTTACTAAGTGAGTCAAGTATGCATTCCAGCGCTGCCTGCGCAGCTGTCGTGCCGGGAGGCAAGAGGGGTGAGTGGT
GGGACTTTCGCACTCGTCGCGGGGCGAAACGCGGTTTTCATGTACTCCACCCTATGAAAGCCCGAATCTGAAGCACAAATTATGCTCCATTTCATGCTCC
CGGTGCGGAGTAAATTCGATTGGAGAAATTGCGCTCGGACCATTACCACGGCAGTCTGAGACGTTATTGACCACTGAGCGCCAAGAGGCTACACAGTCAA
TCGTACCTATGATGGCCACACAGTCTAGGGCTACCCGGACGGCTATACAGCCAAATGTACCTGAGATGGCCATATAGCCTAGGGCAGCATCAGTAACAAA
GATGACCATACGGTCCTACTCCTGCGATGGCCATACAGCCTAGGATATATTATGCACCTGATATGGTTATACAGTCTAGGACTCCTCCTGCATCTGAGAT
TGCTACACAGCCGGGGACAGTCGAAACGGACTCAAGGTCTGATGACATGTATATACGCACTGACTTTGTCGCACACGCACCGCGCACAGCGCGTGACGTA
TGAACTAGTGCAAGGGCTACTCGGGTAACCGAAAACGCAGTCCGTCACGCTTCAGGATTCGAAGCACTTCGGCGTCTAACACTGAACAAGGCTCTGGGGG
AGGTTGGGCTGCGACTTCCAACGTCGTCGTATCCTGCATCCGGACAATCGTCAAGCGGGATAGAGTTTCTACTCAACACGCCTCTGCAACGTACACTCTC
TGAATTTGTCCGCCGGACGCGGATGCCTTTACCGGCTCTAGTGGAACTTGTACGTGGCCCGACGGAAACAGATTACCGGCCAAACAAGCACATGGTTTCG
GCAGTGATCACGGAGGTGTGTAAGAACTACCAGCATCTAGAGAAACCGCAATCTATCGCAGCGGAAGGCGTGCGTGTGGAGCTTAAGAAGGACGTGCCGC
TTCAATAGCATCCACCTAATAACCACGGGTCGGCAATTGA