Description :
From Genome Similarity Track
Location :
Scaffold_1059:5891- 6942
Sequence
1051 bases(100 bases per row)
GCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGGTTGGAGACTTAGTGTTGCTAGACACGAGGAACCTAC
CTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGA
CCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTCTGATCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGAC
CCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGTCGTCGAAGCAGGCACCCAAGCCTTGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTA
CGCAGGAGGGGCTCCATACGAACGAGCCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACCCAGCATACGCGTACGTCTGGGAGTGTGCCGCA
GGCGGCTCCGGACGAGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGTCGAAGAGGCCCGGCGATCCACCCGCAGGTGCA
GGCTCGCGACCTCTCGCTCCAGCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTTCTGGACTGGGCGGCAGCATCACCGCCAGTCTCAAG
GCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAGCCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGAACGAGAGTGGCT
CTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCTCTTGCTTGACCGAAATGGAGAAGTTCACTTCCACGTGGAGCGGAATCTCAGGA
GCACGGCGTCCGCGGTAGCCACAGCTCCTCGTGAAGTGGAGGGTTTATGCCTCTCCGAGAACTATGGAACCGATTGACCGCTCCTGATTGATGTCGAGGC
TGCGCATTCTAGGACAGAACGGCGGCAGTTTCATAGTAAGCGGGGCTTCTT