Description :
From Genome Similarity Track
Location :
Scaffold_1511:589- 3392
Transcript NameFunction/comments
Phymu_g13363hypothetical protein PHYSODRAFT_328401

Sequence
2803 bases(100 bases per row)
TCGGTATAGTATACGTCGGGCGTTCTACCAGTGGCTCCGCGGTCCCTTCCGGGGTCTCGGGAGGTTCTGATCGAGCTTCAACAGTAGCTTCCAGAGCTAG
ATTCTGCCACTCCATATAGCGACGGGACCCCACTGACACAAAACCTGGTGATCTGGGTACCTTCTCTCGATCTAGCACCATTCCGACGTGGAGTCGATGA
TCTAACCTTAAGATCTTCTCACCCAGGTTCGTGATCACCAGATATCGGGTCCGTCCTATGCCGTTCACCACCGTTGGAACCCACTGTTCCCCCCTGGTCA
CCCAGAGTTTCTCCGTAgccgacagcttcacccTGGCGTCTGTCTCCGCTGAATCCCCGACTGGGATCTGGACATCCTCTTCGAGGGCGATCGATCTTAC
CTTATCCTCGTATAATCTTTTACGACCATTCAATGGAATACCGATCTCGTCGGGTAGACACATCGACCCCTTGGCGAGATCCATCCGGACCCCGGCCGGG
ATCATGAAATCCATACCTAGGATCGCATCCTCGCCGGAGAGATCGCCGATCCAGATGTCGAAAAAGTAAACCGGATATCCTGCCAGCGTGATCTTGATCC
TAGCTCTCCCTTCCGTGGTATACACGTTATCACCAATTCCCACACATTCCTGTCTCTGACTAGTGTCAAAGTGGCACCCAACCTTACGAGCAAAGGTCGT
ATCCAATATAGATACTTCGGCGCCAGTGTCCAGGAGCAAGATCGCTTTCTCATGATTGATCTTGCCTGAGATCTTGGCTTGTCGAAACCACTTCCCTGGT
GCATGATACTTCCAGTAGCCTCGGGACTCTCCATCTCTGAGATCCAAGGCCACTTCGGCACCAGATCGGCGGAACTCATCGATCCGAGGGAGATTCACGA
CCTCAGCGGTGTATGGATGCAATTCACATGTATTACCGCGTAGATCAGATTCTTCCCTACCTTGATCTGCCGACTTCTTGTTCACGTATGCGTAGACGCA
GTACCTAGAACGCTCGGCTCGTACCAGATTCCAACCCGGCGAGCGTCCTAGTTtaacttcttctccaccttctcggGGAACATCCCCGCATGTCGTGTCG
GATCATATCATTTGCGGATCTGGTTGTAGAACTCTTCCATGAGGCATTCTCCGGCTTCGTGGACCTTTCCACATCCACGACACACATACAGGCAGCGATC
GGTTGGGTGGCCTCGTTTTTCACACTTCTTGCAGGTCAAACGCTTCCAGCAATCACGATCCGTATGCTTTCGGGACCCGCAGTGGGAACAGCGACCCCGA
TCCTGGTGATCGCGATCCGGGGCGGTCCGGTGGTCGGGGCTCCGAGTTCGATCTTGCACGTTCGGGCGAGATCGTGTTGGATCCGGCTGGCGGGAtccgc
ctccagcaccgacagGCTGGTCTTCCGCCGCGGTTAGGTAGATCCGCCGTAGATCTCCTTCGGAGTCGGACCCATCTGACCCGGACGCCCCTTCCGACTC
TGAACTCAGCTCCTGAGTCTGGATCGCGCGAACCACCGCCCTGGCGGGTGCCGCGGGCGCGTTCGCCGGGGTCTTTTGTCGATACTTCGACCCGAACGCG
AAACGTCGTTGCCTGCTCTTTgctcgttctcgagctcgaagaatttcttcgagatcatcgacatCACTCAGCCGAAGTAAGGTCAGGCGATCGGCCAGTT
CTGGATCACCCAGGGTCTCGATGAAATGATCGACGTGTTCGCGGCGGGCCTTAGGATTTCCATCCTTGATCTTGAGTTTCGCTCGCAAAGCGGCTACGTT
CAGACGATATAGATAATCGAGGGGAGTTTCTTCGGATCGTTTGCGCGCATGGTAGTACTGCCACGCCACCGACATCCCCAGACCACAATATTGGGTCTGA
AAACTGTCGAGCAGATCTGCCCACTTGGTTTTAGTCGTCCGACTCAACTGTCGGTACCAATTCTTCGCCGGGCCGATCATGAGGTCTGCAAAAGTGAGGC
ACTTCTCCTCTTCGGTGGCCTGGTCTCGCTGGAACGCAGACTTGACCTTGCTGATCCAGGCTCGGGCGcgatcttcatcgagatcTTTGCCGGCGAATTC
TTTCAGATCTGAAATCGCCGAGATCCGAACCCTTTGGATCATCGACGATCCTCCTTGTCCGATTGCGGCTGAGGCCACAACTGCCTGGCTTGTGGCCGTT
CTCGTGGGACCTGCGATTCCCAGATCATCCGGGTCGTACTCCCACGAGGGCTGATCGGGGGTTCCGACTGATTCCATATCGACATCCTGCGCCCCCATGT
ACATCGGGAGGTTGTTCGATCTAGGGGCTACTAGGCTCTGTTCCTTCAGAAACCGATCCATCGCCATCTGAAAATATTCGTCCAGCTTGTTACTGGATCC
CGTCGAATTGGTTGTCACAGTAGCTGGATCGGCCGGGGCCTGGCGATTCTCTCGCCGATCCGGTGTCTTAACGGCCGACTTTGACCCAGCTGATCGTGGA
TCTTACTTCTTCATGCGTGATCTCAAGAGCTGGGCCCCAGAAGGGCCTAGAGACATTCTCTGCGGTCCCTCAAGAACTATCCGAGTCAGGTTCTGAGGTA
GCTGACGCATAATGGGAAGATCCGGTCTGATATCCGGgatccagcgtctccaagcgTCCACCTACCAAGATCTTGAAGACATCGAAAAGGCTTCTGGTCG
CAGACTGGATCGAGCCGAGATCCAAGTCGAACAGAACGTTCGGATCGAACTCTCCGGCCACCAGGCCTACCTCTTGCAGCATATCCAGCAGAATTTTTAC
TGC