Description :
From Genome Similarity Track
Location :
Scaffold_115:58896- 62770
Transcript NameFunction/comments
Phypl_g3475Di-N-acetylchitobiase, putative
Phypl_g3476hypothetical protein PHYSODRAFT_543861

Sequence
3874 bases(100 bases per row)
CGCAGCGTAGTCCAAAGTGTCTGCGTTCCACATGCCCACGCCGCGCAGCCCGAGCTCTCGCACGAGTGCGTACTTGGCCTTGAGGCTGCGCGGGTTGTCG
AACCAAATCTGCGACCGTCCGCCCTCGGGCGGCGAGTACCACACGAACGGGGTCAGCGTCGTGGGGTCCCATTGCTCGAGGAGCCCGTGGGCCTTCACCA
GTCGCCGGACGTCGCCGTAGTCGATTTGTCCACCGGCCGCGTCACTGCAGGGAGCGCCGAAGAAAGGCACCGGCCGGACCTGGCACCACGAGGCGTCGTC
GATTGCTGCCTGCTCCAGGCACGGGTAGCGGTAGCCGTACCAGGGCACCCCGAGCACCAGCTTGCTCGGCGCGATGGCGTAcgccagcaggaactcctGC
AGCCCTTGCTTTACCAGCGCCCAGGGCGAGTTGGCACCCGCGACGCACGCGTCGTACACTTGACTGCGCATGTCGTACGACATGACGAACAGAAAgtccg
cggcggcggcgagctcgcGCCATGGGTAGTAGCGGCCATCCACGCCGCGAGGGGCCCAGGGAACGTCAAACGTGATCTGCGCAAGTCGAGCGTGACACAT
GCAAGGGGTCAGCACGAAGGGGCTCGTGTAGGTGATCAAGCTGTGAAACCCGTGCTGGGAAACAACGGACCTGCGCGTTCTTCGTGAgtgcgtgctgctc
cagctcatgGCGCAGTTCGTGCACGAGCGAGCCAAGGCACTGCGAAGTGGCCCCTCGCATGGGTTTCTCTGTGTCGATGTTGACGCCGTCCGCGAAGTTC
TCGACGACCTTGTTGTACGTTGTCTGTAAGAAACCAACGCAGCACCACAGTAGTTAAGGAGCACGCTCTGCCCCCACCAGCTCGATGCACTCAGTAGTAG
CACAGATCTCGTAGTTCGCTCCAACCTGGATCCATTCCTGGCGTGCTGTGACGTTGCACAGTTGATCCACCTCGTCAAAGTTGTGCTTCACCACAACCTT
CACGCCCTTGCTGTGCGCGTGGcagagcagctccttgtcctcgttcCAGGCCACCGTCGTGAGCTAGCAGCGCAACACTCGCTCAGTGCCGTGACAaccg
acgacagcagcaacggatccgttcagcagcgcgcacCTGGTCCCAGTCGTAGTGTTTCCAGCGGTCGTCCGTCGCcacggagaaggcgaagaccTCCTTC
CGAGGCGCCCTGCTGGCGTAGTCGACGGGCAGACACAGCCACGGCGAGCTGGTGAGCtcgtcactgctgcttgggcaCGGGCAGTCGTGCAGACGAGCGC
GGTCCTCCTGAGTCAGGCGGTCGGCGAAGAGTCCCTTCGCGTCGTACACCGGGACGGAGCGAGAGACGCATTCCCTCGccagtgccagcagcagcagcga
gacagcagcaagcagtcGCGGGGAAAGCCGCTGCATGGTCCGCTCTTGCCCTCGCTGTCGCGATATGGTACAGCGTACCTTTCGATCTGATTACGCAGGG
GAGCCAAAGATCGCACAAAACGTATCTTTCGGTGGTCGACCTTGGCGTCCCTTCGCGCGCATCACCCGATTGCACTCGACTATACGCTAGGAAGGCCATC
ATGGCTCGGAGCAACAGCGCGCTCATGATGAGCATGGGCGCCGTCAGCATGTGGGGCTTCTCGCCCGCGTACGACGTGTGCAGCGGCTTTCCGGAGTGGA
GCCAGAGTCAGAGCAAGAGCTCGACTGCTGTAGACGGTGCGAGCGACAACGACAGCAAAGGGAAGGCGTCTGCGGAGCCGATCAACGTGCTGCTAGCGGG
GCCTGGAGACGTGCGTCACGTGCTGGCGACGATCGCGTGTCGGCGTCGATGGGAGCCAGTCTTGAAGCACCGACCGGTGCACATCTACATTTTCGAGAAG
GCCGTCGAGACGCTGTCACGCGACTTGCTGCTAATCCAAGTTGCGCTCGATGCAGATCTGGCACTGCGTCAGCGCTGCAACACGCTTCTAGAGATATTTG
GCAACGCTCGGGTGCAGGTACGTCAGGAAGGGATACAAAAGGGCGTACAGGAACGGAGAGACTAACGAATTGTTATATAATATGTTATATGAAGGAGAGG
ACGAGCGCATACGTCGAAGAGCAGGCGAAGATGCTGATGGAGTTCGTTTACAATGACCGCGGCTCATTGGCAGGTCTTGTAGATCTCTCGCACTTGAAGA
TGCGCACCCATGATGATCTCATCGACTCGTTCCGAAGCTGGTTTCAGAGTGTCAAGTTTGACGGTAAGAATGAGATCGAATTGCGGGGGGATCGGGGGTG
AAGTATTAATTGACTGGTGTACGTGTAGTTGACACACTTCGAGATCATCGTCTTCGGCACTACTACGAAGCTCGATACGACTACCGTGACAACCTCATTG
ACTGGGATTACACCGTGAGTCATGTACACCGTTGCTTGCAATGCCCAATTACCACTCGCACATAAATCCTTACATTTGTTTATACCAAAGATGAAGCTCA
AGAAAATCGAGAACGCCAGTGTGATTCACATTCGCCAATACCGCGATTGGAGAAACTCTGGTGTGGCGTTTGAATTCGGCGACCAAACGTACACCGTACC
AAACCGCACAATGGCAGCATACACAGAGGCAAGAGTCGTTTGAATCAGTCTCGGTACAAGATTGAAGGCCTGACAAGGTGGTCACCGATGCGTTTTGAAA
ATGATAGGCAACGAAGAAACACCACGGATCTGTACTGTGCAGAGGCTTGTGGACGGACATCATTGTGAGTCCGTACGTCTCATTTGGTGTTCACTGTGAG
AAGCCCAACAAGTTAGTGGAGCAACTCTTCGAGATTCATAACAAGGGCACGGGGGTTGAACAGAACCGTCATGTACGTTGATGCGGTGGTATCGCTCTTG
TATCCTTAAAGTTGTGGTCCTAACTGCTCACGCTTTCGTTCATTTATCTCAACAGAACACAGTCGAAGTTGCTATTTACAATGTGCTTTCGTATTTATAC
GAGATCGAGACAGGAAAGATGTATCAGATGGAAAAGGTGTTGTATGACTTGTGTAATACTCTTCCTCGGTCACTCGATTAACGTCGTGGGTCTTTGTACT
AGGAGCATGACATTTTCAGCGGAATCGGCGACGTAGAGAAGACAGGCGCTGATAGTGGGAATCAGCCAGCAGATGACAAACCAACCCCACGCTTCgaaga
gatcgacgagaagtATGCGGTTCATAGTTCTCTTAACGAGTACTACTTTATGCTAACCGCTCTCCTTGTCACCTTCAGGGAACCACGTCAGCAACAAGTA
GTATCGGATGAAGCTCAACGACACGCTGACACCATCAAGGAGTCTTTGCAGGGCGTGAAGGTGCATTTCGATACAGAGTTGAGCCGTTGTGTATTCAGCT
TGTACAGGCACTCACTGGATAATGTTTACGCTTTCCACACCACAGCTCATTCCACTAACGGGAAGCGTGGAGGACTTGTTCTCGAAAAAGCGCTACACCG
ATCTCTTTGACTACGTCTTTGTTTCGTCGCAGCAGTGCCACATACTTCAGCCCTCTATAgacgtggagcagcaagcgccagcagcattcACAAACATTTT
GAAGGACGGTGCCACCGTAGACATCGAGTCTTCTGTGTAAGTACACTGTGCGTCGTATATATGGGGAAGATGCAGACCGAAGGTTTTAACTTTGCCTGGG
CGTACAGGTTCATGCTACCTCTTAAAGAGGAGCAAAGAGTGCTCTACGTGGCAAAGCTGCAGGAATGGGCTGGACATCATTCACTAAAACCCAAGTTTGA
CTTTCGCGGCAAGAACGAACCTTCAAACGAAGACATGGCTAAGATCAAGAACGCAGTACTGCGGTTTAACTATG