Description :
From Genome Similarity Track
Location :
Scaffold_172:58862- 65369
Transcript NameFunction/comments
Phyin_T30-4PITG_20563Putative uncharacterized protein

Sequence
6507 bases(100 bases per row)
AATGCCCGGAAGCAGCGGAACATGCTCCGGGTAACGGTCGATAAGTCTATGGCGGCGACTTGCACTGCAACTTGCCCCATTAAGGCACTGCCCGCGATCT
CTAGCTCCCTCCTCCCTCCCTATACCGGCGGCCTTAGCGAGACGCGCACGTGAATGCGCTTGGCGAACTTCGCTAGAGATGACATCTCTGCCATGGTCTA
GCCAGCCCACGTGACGACCAAAGTTGATCGCTACATCACCTCCATGACTAGCATTACATGTACTTAAGTATCGTCGATAAAGGCCCGCGAGGTATTTAAG
GGGGGGGGGGTATGGTGGAAGGCGGCGCTGAACTGCCTGAAATGATTTCTTCTGTGTTCCTTTGGCTCTCCTTTAATGCAGTGGAGTTCGAGACCCCGCC
AGAAATCACGAAGGACGGGTACGAATACTGCAACATCCTCCAACGAGAAGCCCACGCTCAGCCCAGCGGTGAGAGAACGTTGCTCCGTCGCAAGTAAGTG
CGAGTCACTCGTTGCGGATCTTTTGCCGTCGTCTCCGTTGCACTGAGCCGACTCGATCTTCAAAGCTCAAGTGTACAAAAACGAGTCATCGAATAAGAAA
CCAACGGCAACACCTGCAACGTTCTACCGATTATTGGTTTCGTTCGCGTCCGAGCAGACGACAGACGGGCGAGCGCTGGTCTCAACTTATTAGCCCGCGC
CCCACTTGGAAATCTCCACGTTGCGATGCCTGAACATACCGGTATACAGCATACCCGTCCGTGGATCTCGCTGCTCCACAAGCTGCTGGCGACAAATAGC
GACGGTTTCCCGCCGCCCGTCGTTGCCTGAAGCTGCTGTGTCCGCTTCCTTTGCAAGCCGCTCGTCACGCACAAGCGCTGCTGCAAGCTGGTGCGCAGCA
GCAGGCATCACTTAACGCACCCCACTTGCCCTTTCCGCCACCTTCCCTGCCATCCAGTCTGGCGAGAGGACCATGCGTCCTGAACTCGTGTCCAAACACC
AGCATGATTTGTGTCCAATGTTAACGTGGCACGCCACAGTGGCGGCCACGTACGTGCTGCTGTTACTTTGCGCCTAAAGGGCCAATCGGGTGTTGGTATT
TTGCCGCGAAGGGCACGGCGAAGGTTGCCGTCATGATTTTTAGATATTGTCTCGGTAACACAGCCCCAACAGCTTCGACTTGACCATCGTACAATACCGC
TGGCGATCAACGATAACTTAGAAGGAGAAAGCGCAGAGAACACTGTCGATTCTGAGTTGCTTAGTCTAGCTAGTCGAGAGGCCGGTCATTTCGCTGCTAC
TCGGAATTACATCTTCTACGCATTTACCGGTATACTTACCGTATTCCTTATGTGATTGGCGACAGTCAAATTCTTGAGGTGGTCCAGCCTTTCTGCCAGC
ATAAAAGATACCCGCATAGAAAAAACTATATGACATGCTCAAAATTATATTGGTCGCCAAGCACATAAAGCGCGACGACACGAAATTTAAATCAATTTGA
TTGGCTGCTGGATTTGTCGCTAATGACCGAGCGTCGCCAATCACATAAGGAATACGGTACCACAATTGTTGAGTCACAGCAATCACATGTCTTCGATTGC
ATCCGAGATTCCCAGGGCACCCACGCATTTCCAAACTGGGAGTCCCAGTGGCGGGATTGGGACCAGTTAAAGTGGGCGTTTCGCAGCGAGTTATGCCACC
TCTGTTTGATGCTGTGCGAGCAGGCTGGTATCGTTGGTGTATGTCTTCTACAGTACCGGCTTCTGGATAGCTGGCTACGTGTACCTTGAAGCGAGTCTTG
TGCCACAGGAATAGTTGTTGGGGAAAATGGAGTGTCGAGACGTTGGAATGGCGAAACGCCCCACAGGTGACCAGTTGTCAGGACGACATGCGTCAGCAAC
TTCAGTATCCTATAGGGCCCCCAAAACAGTAGGGGTGACATCGACTTCCCGCTGGAGGTACTGTAGCTTGATTCTATGGGCTTATTCTGTCGGATGAGGC
CATTGTCGAATGCCGGCTGAACCGAAGGATGCACGTAGCGTACGTCGTTCCTTCTGTATTAGGCTTGGTCACGTAACTTTGAACCAGTGGACGCCTTCCA
AAAATAAAGTAAGCACCTGACATATCTGCAGCAGATATGTCAGGTTTTATCGACCTCTATGTCGACTTATATGTTTTGTGCCCCACCACAAATCTAGTAA
GAGGAGGAACCTAGGCCAGTGCAAAGTGTCCCCTCCGCAAGAAGGTACTTGAGTTTACTAGCAGTTTTATACATTGCGGCAATTTCTATTGGACTAAAAA
AATTGTACTTGAAGCTCACCACTTCCCCTTTAGAGACTCTCGCCAACAAGATGCACGAGGAGGACGATGACGTTGACGTGCTGCTGTTATTGAGCGCCGC
ACACTCGTGGCGCGAAGCTAGTTTGGGTAGTGTCCGCCGTGAAGTGCACCAGCAGATGATCGTGGCGCGTTGCCATGCGTACACGTCACTACCTGACGGT
GTCATGCTTGGATACAACCTGTGCGGCCGCGTGGATGGCCCTTTACCGGAACGGCCTCGACACGAACTTCATAAACGCTACAAGCCTCACGAGGTAGGTT
TTATTGACGAGTGGATAATGTTCGCACTGTTCGTAACAACTGCTACTATATACTACGCAGAGCTGCCTTTAAACACCTACTTAAAAGATTCTCGCATCTG
CAATGCACCGCTCGCGCCAATACGTGGCCGAGTGAACCATCTCCTGCAAGTAGGAAGCCAATTAGCAAACATTCTTCTCCAAGCTTCTTGAGTACGTACC
TTTCGTTACGATGGCGGCACTTTGCCCTCAACGACCGATTTTCGAAAGTGTGGGCTTCTTCAACTTGAGCGCAAAATGAGATATGCGAGATATATGCAGA
GAGAGAGTGATTGTGGGTCAGTTCAGAGCGATGGTCAGCATTTCTAATACAAAATTCTAGATCTAGCGATAAGATGGCTACAGAGATTAAATATAGGGGA
AGGGTAGATTACTCAGACGATTTTTACGCCCCACGGATTTTATTCGATCGTTATGCCTGCAATATCTGCTGCAGGTATGTCAGGTGCTTACTATATTTTT
GGAAGGCGTCCAGTGAGACCTCGGGCAATGACTGCGCTGGACAGGTTTCAAGCCTATGTCTGACCACTTTGAAGTTAAGCGTGTAGGGCGGAACAGTGCC
AGGGCATAAGTGCACAACGTAAAGCAAAAACAAACGCAAATCCAGTGCACTGATATTTTATTTGTTAATTCAGTACAAAATTTACGCCAATCTACTGCAT
AATCTTGGCGTCAGACGCGCGAATCGCGGGCGCGCAACAGCGCTTTCGGTCGCGATAGGCGTCCGGCAAGGCGGCAACTTCCGCGGACTGCTTAAGAATA
CTCTGGACGGTAGTGCGCTTTACTGCTCGGGGGGTCTTAAAGCGCTCCGTTGCCCCACGAGCAAGTTCGGAGTGAGAGCATGCAGGATCTGACTTGTGCT
TCTCGCACAAAGACTGCTTTTGTGGGACATGTAGGAGGAAGGGCGATGTCCCATTGTCTTTGGCGGTAAAAATCAAAGTGTGTGTAAGAAGACGTCCGAT
CCAAAATTTAAAATCAGATCGATGCGGCGTGTCATCCCTCGGCGAGGAGGGGAAAACCGTTGAGGTTAATTGCTAGGGTGGTGATGGGCAAAGGTAATTG
CGCATCCGTTTCGCGTAATCATAAAATCTGGCAGGGTATCGACTGATACCGGTGTCGAATTGGAGGTGCACGACTGTACTGCAATTTTTTCAGAATATCT
GCAAAGTAAGGGCAAAATCACAACAGATTGTATCCGAGTCATAAAAATGGATCTTGAAATATAAAAGAGAGTGGTTGCTGTTCCAACCTAGGAACCACTT
GGTCACGAAAACATGCTACCCTAAAACCTTCAAATAAGGCCTATACGCTGGGTTTTGCATCCGAGCATGTATACTGTGCAGTCAGTCGGCCAGGAATAGA
AGCAAAACTGACAGGTGCACTTGCACAAACGCATTTCCCCAGAACTCTCAGAAGCAATGGCCAGCGTTGCTGGTAGAAGAAAGCGAACAGACACAACGGG
TGTCGACAGCTCAAGAGGCGGCGGAGATATCTCAGCAAACACGAATGAAGATTCGTCGCTCGAAGTGGAGTCTGCTTCGTCGCCAATGCTAGTAGCATCA
CCTCCTTCTCATAGTGCTGGACCAGCCTTGAAAAAGCTCCAGTTTGATTCGTGGGATGAATTTCATGCTTTTGTGCGTGAGTATGAAGCACAGACCTACC
AGGTACTGCCTAAACTGCGATACGAACTACAAGTGTTTCAAATTTTCTAACCATTGCCACTTAGCTGTTTCGAATAAGAACAAATAAAACGGTGAAAGCT
CGAAATGCGAAAATCAAGAATCCAGCTTCGCACATTCCACATTCTTTCGAGCAGTACTCGAAAGGATTAGAGTGTACTCATGCAGGAAAATACAAGTACA
GGGGCCAAGGAAAAAGGTTGCGTCAAGAAAGCCGTCGGATAGAGTGTCCTGTACAGGTTGGTGTGGCTTATTCTTTTAGAACTTGGGAGTCTGTAATTCG
ATTCCAGAATATTTATTCTGGAATCGAGTTACAGCTTACCACTTGACGCTATACAGACTCGCTTCATCGGAATATTTCTCTTGCTCGTAGATAAATGCTT
GCGTGAAACTGATAAACCAAGACACTCAAAAGTGGGCAGTGTGTGTAACAAAATCAATGCTCGATCACAATCACGATCTCAATGTGAAGTTGTTCAACTA
CTATCCCAAGACGCGCCTAGCACTTCCAGCGGAAGTTGTCGAGACAGTGAATGTTTTACAACAGACTGGTGCAAGAAAGAAGACTATTCACCAGTACATT
CTGGAGAACTCGAACTGCCTGCCGACAAGTCGAGATGTCCACAACCTGGTCCGTACGTTGAAAAACGACAAGTTTGGGAGCACTTCGCGGGTGGAACGAC
TCAAAATCTGGATGAAGGACTTCAGTGAGCAGCCAGGAAACATTGCGCGGATTTTTACAGACATGGAGAGCGGCAAGGTAAGAGGATCGTGTACAACATT
TTATTATGTCTGACTGTCTTTAATTTGTTTGTTTATCCAGAAAGTAGCAACTTGTATAACAATACAGACGTCACACATGCATGAAACATTCTCTCGGTTT
CCAGAAGTACTTTTGATTGATGCAACACACGGGACGAATCAGTCAAAGTACAAAATATTTTCTTTTATGGCTCACGATGTCTACGGAAAGGGTCAGTTCG
CTCAGCATTCCTAAATTAAGAACGAAAGATCTGAAACACTACAAGCAGCAATTGACGAATTCAAGGAAAACAATCCGGAGTGGACTCAAATTCAATGTGT
GATCGTTGATAAGGATTTTACGGAAATTTCGGTATTGAAGTCCTCACTTCTGTCCGTTTCGGTTTTACTATGTCAATTTCACGTTATCAAGTATCTTGTA
GAGGAACTTGCGAGTGGAGTTTACGGGTTTAGTATATACCAGAAAGAACAATTACGCAATTGCATTCGACTCATGGTGTACGCTAGAAGTGAACGTGAAT
TTGAAAAGCATCGGCGCTACATGAAGCACATGATTGAGCTCGGCTGTGGTAGACGCAGCTATGAATACCAGAACCAGAGCTCTTCGAGATACACTGGTGG
TGTTTTTAATGAAGGACCCGAGAATCTTCCGAATGAATTTCTGGAGCAAAGTGGCTACATCATCGATCCATTATCTGTTGAATCAAACGATCAAGAATGG
GTTCATCCTTTTGAAGCCTATTTTAAAAAGAACTGGGATACCTGTAAGGAAATGTGGTGCTCCTACACACGGCAGAACGCTGTTACACTTGGTAACAACA
CCAACAACAGATTGGAGGCGTCGTGGAAACAGATCAAAGATGTTGTGAGCAGTAGTATGGGTCTTGACGAATGCGTAGCAGCTATCATGCTCTATCAAGC
TCGAGCCGAGCAATATTTGGATGGACAAAATAACAAGGTATCTGTCGTTCACCATACGGAATACGATGACGAGATGACAGTGATTGCGAATTTGGTTAGT
CGACATGCCTGTGAGCTGATATACGAACAGTATAGTTACGTTCAACATCGCGCATCCTACAGTTACTACGAAGCATTTCCGGGTATTATATTTATCAGGA
GCAATAGAGAAGAAGATGAATCTCTGGATGAGCCGAGTGTCGAGTATACAATTCAAAAGCAAAATTGGCACTGCTCGTGCTTATTTATGAGCACCCGGAT
ATTACCCTGCAGACACGTTTTCTACGTTCGTAAGGCTATGAAGATGGACACCGTCATCCCAATAAAGATGCTTCATCCTCGTTGGTTACTTTCAACTCTG
CGTCAGCGGCCAGCTCACAGTAATGTACAGCCTACTCCGTTCCGTGTTAAAACAGTAATTTCGCGCTCATCAGTACAGACATGGGACTGCAATCGAAAAT
ATCGAGA