Description :
From Genome Similarity Track
Location :
Scaffold_1412:5886- 7258
Transcript NameFunction/comments
Phyta_totarag12919Amino Acid/Auxin Permease (AAAP) Family

Sequence
1372 bases(100 bases per row)
aagtcgacgaagtcCGAGAAGTGATCCTTGAAGATAATAGACAGAATCACCAGCACAACGATGATTGCCAAACGAAGCACAATGTACTTGATCGCGTTGG
CGCCACGGTACTCGGCAGCCTCGAGCTCgtggttgttgttgatcTCGCCAGTAAGGGGGAAGACAGACGTCCTCGAACGACGGCTGGACGTCACCCTTGC
GCGGGGGACTTCACTCACCTTGTGAAGGTCAGTCGCAGGCGTGCCGGATTCCTGGTAGGCCAAGCcgttctcgatctcctccgaGTGCTTCTTGtgcatg
cccagcaccacTCGTTCGGCAATGTAGAAGGCCGGGTTGATCAGCACCGAGAAGGCAATGGTGACGTGCATCTGCATGGCGAGGTATGCCAGCACGACAG
TGCCCCACTTTGGGACGAAGCCCAGCGACGTGAGACCAGTGGTAGCATCCGGGTAGATAACGTACAGCAAGTTGCCCGAAACTTGGCATCCGACCGAGAA
GTACGGCACAAAACCCAGGATCAGCAACAGACACATGATGAAGACCATCGTGACGGTGACAACGCGGGGAATGCGGCTCGGGTCACtgtgctgacgctgc
acgTCCGATAAGACGATACCCGCACCAAAGCCCATGGCGAGACTGCCGAACGCACCGGCGATTTGGGACAAACTCAGCTCGGGCGACGGAACGGACGGGT
GGTCGGGCATGCCATGGGCCACAATTGCAATGCCGAGGGAATCGGCAATAAGCGTTCCCATGCAACCGGCGAAAGCCGCGCCAGCACCTTCCTTCAGGGT
GGGCACCAAGGCAAGCGGCAGCACCGTGATGGTCATCAAAATGATCCAAGTCGTAGTGCTCCACGCTCCGGGGAAAAGTCCGTCGAGCAGTCCACCGCCG
AGCACGAGGAACACACACGGCATGAGTAAGCAAGAACCCATCTGTGAGACGACGCACAACCACCGGCCTGTCTTTCCCATGCACCATTCACCGAGGTCGC
TGAAGGTGTTGACCGAGTTGGGGGCCAACAGAAGCACCTTGGACAACGCGACCGACGAGTAGATGTTGGAGAGGGCCATGAACACGGTGGCGAAGAAACC
GAGGATCGGACCTGCTCGCGCAAAGTTTGCCGGCATACTCAGCGTGCCGACGCCGCACATGCAGCAAAAGAGGCTGAAGGAGAATTTGGCATCCTCAAAC
GTGAAAAAGGGCTGCTTGGCCATTGTGTCGCGGTCGAAAACTGTCGGTTGGGACTTGTAGACTGCGTCGTTGGCAGCCAATTTCAAAGTgagcaagagca
acaagAGGTGCGCTGCACGGCCAGCGAGTTGGGCGCTGCCGTGGCTGCTCCCTTGTCCGTGCACGCAGCGCG