Description :
From Genome Similarity Track
Location :
Scaffold_204:5884- 9686
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_204-fgenesh-gene-0.2Transmembrane anterior posterior transformation protein 1 homolog
Pytar_ATCC12531maker-par_contig_204-fgenesh-gene-0.6Pumilio RNA binding protein

Sequence
3802 bases(100 bases per row)
GTCGCCCACGTCCATGCAGCGCATGCAGCGGATCCACAACCTCCAGATCCAGACCGATCTCTCTCTACCGACACCGTCAGCCTCACCGCCGGCGTCGCCG
TCGGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACCGGCCACGGCTTATGAGCCGGGCGGCCCACCCTTCACCGCCACCGCACCACGGCCACCA
CGCGCCGTTCCGACTCGCAGACTTCCTCTACAAGGAAGTCTTTGGCGTCCACGACATCAAGTCGAGCGACGCGGTCCACCAGGAGCGCGTGCAGAACTTT
CTGGTCGTGCCGTACAACACGGAGCAGCTCTTTGGCTTTGGCGTCTTTCTCGCGCTCGATAGCTTTCTCTACGTGTTCACGTACCTGCCGCTGCGCATGC
TCTTTGCCTGTGGCTGCGCTGTCACGTCCGTCTCGCTCCACACGCGCATTTTCCACCGCACGCACTTCTACGACCTCATGGTCGCCGTGCTCATCGCCGT
CGGCACTAGCGTGCTATGGCAGGTCGACATGTCACGCATGTACCACGCGATTCGCGGCCAGGCCATGATCAAGCTCTACGTGCTCTTCACGATGATTGAG
ATTTTCGATCGACTCTTTTCGTCGTTGGGACAGGACGTACTGGACTCGCTCTACTTTACGGCACGCTTTCACCCGCGGCGCGTCACCCGCATGGCCATGG
ACTGTGCCGTCGCGCTGGTCTACGTCGTGCTCCACGCGCTGCTGCTGTTTGCGCAGGTCGTGACCATTAACGTCGCTATCAACTCGAGCAATTCGTCGCT
GCTGACGCTGCTCATCTCCAACAACTTTGCCGAGCTCAAGGTACGGAACCAGAGGGGTCTGTGGGGCCTGAGTCTCTATCTCCAGTTGCACTGACGATGA
CTTGTGTGACAGAGCTGCGTGTTTAAGAAGTTTGAAGAGCAGAATCTGTTCCAGATCGCATGCAGCGACATTGTCGAGCGCTTCAAGCTGCTGCTCATCA
TTGCGCTCATCATGCTCCAGTCGAACGCACGCGACGTCGCGTACGGCACGGTACGGTCTCTCATGATCCTCTCGTCGGGTGGTCCCACACCAATCTCATC
TATATCCTCCTTCCCTCTATGTAGACCATGGTCATGCTGGCCGAGATGCTCATCGACTGGCTCAAGCACGCCTTCATCACGAAATTCAACCAGATCCCTC
CGTCGGTCTACTCCAAGTTCATCACGATCCTCTGTCGCGACCTCACTGGGTGGAAAAATCAAGACACGATTCTCGACCACACGCACCACGTCTCGAGACG
GCTCGGGCTCGTCTCGCTGCCCCTCGCCTGCGTCGTGCTGCGCATGGTCAGCAAGGCGCTGTACGATCGGTCGCCCATCACGCTCGCCTCGCCCAGCGGC
GTGCTCATTACACTGGCGGTGTTTCTGTGCCTTGCGGCTTTCAAGACGCTGCTGAGTCTCGTGCTCATGATCTACGCGTGCCGATCCGGGCGGCTCGATG
ACACGAGACCCAAGAGCCCTCGAGCCGTGCGGCAGCTCGAGTCGATCCAGCGGTACAAATTCTGAGACCCACGAGCCGTGAGTCGACACGAGCTGACGTC
GATCGTTTGGATCATCGCGCGAGAACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGTCGTGTTTTACGGGTTTGGCTTG
CTGTGGCTGGGAACTAAAATCGGCTTACTTCCTGTTTGTTCTCTTGTCTGGTCTGTTCTCGCGTTTCTTCTTCTCTTGAGTTCTTGGGTAGTAGTTTTTT
TCTTCTTCTTTCTTCATCTTCCTACAAGCGCCTTTCTCGCCATCGAGGGGATCACTATTTCTTTTCAAAACAAAAATGGGAGGGGTTTCCTGCGTGGTGG
TTGGCGGGGGAGAAGAAAGCGTGAGGCGTGGTTGGCATTCGGTTGGCGGGCGTCTCTCTGCTTGGACATACTGATACAGTTTACTTGTACATCGCATCGT
TTGCCGCCCATCCGCTTACATTCACAGGCGCTCGCTCTTCTTTCCCCCTCGTCTTTCGTCTTCTCTTTACATGCGTCCGCTGCCGCCGCTGCCGTGGAGA
CCGAGGCCCGAAGTCGACGCAAACGGCATGGCGTACGTCGTATCGTAGTGGTGCTGCTGATGCTGCTGCTGGTGCTGAGACTGATGCTGATGGTACTGCG
TCTGCATGCCGCCAATGCCACCCATGGCATAGCTCGCGCCGAGAGCGGCTGGCTCAAAGCCCATCTCCAAGTTTAAATCCATGTGCGGGAACCGCTTGAG
GATCCGCGCCGTGATGCGGCGTCCACCCGAGGTGTTCTTCATGGCCGGCAAGTGCGGACGGATCGCCTTGACGAGCGCGAGGCACTGGTCTTCGGCCGAC
ACGCTGAGTGCGCGCTGCACCACGTAATTGGCAAACTGGTCCTGCAGCATCTTCTGCAACTTGGGGCAAATTGTGATTTCGTCCACATACTCGCTGAGCA
CGGCCGGCGGCGCCTTTTCGAGACACTTTTCAATCACGTTCGAGCTGAATTTCTGGACCGACAGTTCATAGACATTGCCCAATGGCTTGACAATCACGCC
ATAGGCCTCGTCAGCCGTGCACGAGTCGAGCACGTACTGGACCACGTAGTTGCCGTACGGATCTTGCATGAGCTTCATGGCCTGCTTCTCCACTTGGGCA
ATCACCTCGCGCTTTTGCTGGTCATTGGCCGCGTCCAGACAGCGCTGCAGCACGCAGCAGCCATGACGATGGGTGCCCACAGTCGTGCACTCTTTGCAGA
CCGCGTCAAACACAAACTGGTTGTACTCGGGCTTCATAAACTGGAGTGCGCGCTGGATCACGTGGTTGCCGTTCGAGTCGATGCAGAGTCGGACGGCATC
ATCCTTCAGCGCGTCGACAATGAGGTCGGGCAGATTCACGCGCCGCAGTTCGCTGCCGTCGCTTGCAAGTTCGACGACCTGGGCCGACGTCGCACACACT
TCCACGACTTTCTGGACCGATCGCGTGCCATGCAAGTTGAGCGCCGCCGCAACCAAGTGGCTTCCCACACGGCGTACCATCTCCAATCGCTGCAATGGTC
GCGCGCGCTCGAGCAGCTTCTGGAAGAGGTAGTTGCCAAACGGATCGACCATCATCTCGGCCAAGTGGTCCATGGCTTCGCCATAAATCACATCACACAA
TGCCTTGCGCTCGTCATAGTACTCGAGTTGCTCCTGCAGCAAGCGACAACCATTCTGGTCCTTGGACATGGAAAACACGCGGCCCTGGACGTCCTCGAGC
TGGAGCAAAGCGTCGACCACGCCAGGCACGGGGGCGGACTGCGACACAGCCATCGCGAGGCTGCTGCCGGGGAGAGTCGCCATCGCGTGGTGCGGGGAGC
CATGCGGCGCCATCGCAAGACCTTGAAGTTGACCCGAGGAGGACACGTGGTGCAGGTGATGATGGTGCACATCGTTGCCGACACTGCCGCTCCCCATACG
GTACGTCGATCGACTCGAGCTACCACCACGCGTCGGCATGTAGGACGATGACGAAGTCGACGGCATGTACGCGTCATACTCGTGGTGGTGGGCCAAGTGG
TGTGGCGACGTCGCCGGTGACGAGTGAGGCACGTGGAACGACTGCGATTGGTGGAGCTGTGGCTGCGGAGGCGGTGGCTGCTGGTGGTACGCAGAGTGGT
GGTGCTGGTGCGAAGGCGGTGGCTGGTGGTGCGCAAACTTGCACTTGTTGCCCATGCGGCAGTGACCCTGCAGATAGAACTTGCACTGCTTGACGCCCCC
AT