Description :
From Genome Similarity Track
Location :
Scaffold_54:5884- 9055
Sequence
3171 bases(100 bases per row)
GACAACCTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGCTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCG
GAAGACGAGTACGTAACCGATATTCGGTCGTCAATGTTATTCGCTGAGAACGAAAGGTTATCAGCAGCTCATCAATGAACGAGGGTGTCCTTGATGAGAA
GACTCGGATATAGCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCTTCTCTACGATGATTTGACGGAATTCAGGGATGTGTTCCCAGAAACA
GTGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGCACGGGGATAGACCAGAAACCAGGGTCAAAATACTGTGTCATGAAGCAATGGCCATTGCCTCGTG
AACAAGTACTAGCGATTGACAAATTATTTGCCGATCGCTTAGCAACGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTTTCCGACCTTCTGTGTCCG
AAAGACCACAGGAGGATGGCGGATAGTACATGCCTGCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAAAGCCGATACCAAGAAAGGATGCCATTATA
GATGGTATGTCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTACCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGCAGTGA
GCACCCCAAGCGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGATGTGTTACGAATCTGTTGAGATC
TGTGCGAGAATTCGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACTGACTCCACGTCCGG
AAAGTTCTTACACTGATGCGTGAGCATAAGTTGTATGTAAATCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGCA
AGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGTCTAGCGGC
GTATTTGCAAAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTATCTCGTTTATTAAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCAG
CGCTCTTTCGAAGGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCTATTGCAGACCAAGACAGACCATTTCATGTGGTCTGAGATGCAAGTGATT
TTGCCATCGGATGTGCACTAATGCAGAATGACACATACGGTGCTGAACGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCGGTTGAACGTAACCACCC
AGTCCATGAAAAGGAACTCCTTGCCATGAATTATGCTTTGGAGAAGTTCAGGTTCTATCTACTAGGTGATAGACCCTTCATAGTATATACGGAACATGCG
TCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAGCGAATGGCGAAGTGGCTATCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATACAAGCCAG
GACGACTGAATGTCGTCGCTGATGCTCTGTCGCGCCGGCCCGATTTAGAACCGGCTGCACAACCCGACACTGGTCCGACTACTGTCGCGGTGTTGACGTC
GAGTGTCCCGTCGTCAACCTTATTCGAAGACATACGAAAGGCGTTCGATCCGGCGATGGTGCGTTTGATGGATCCTCTCTCGCAACCATCCCGTCAATCC
CTTAAAAGTCTGCCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGTGACACGCCTCGTG
TCGTCGTACCGGACAATGGTGAACTGCGTCTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGACATATCTCAC
AGTTAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAACTATGTCAACGAGTGAAGTCAGGTCCTTCACTT
CGTGCACCGTTGCAAACCTTGCCCATTCCGGCGGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGAATTCCCCGCAGACCCACACAAGAATACAG
GTATTCTTGTGTTCGTTGATAGGTTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAATGCATAGGCATGTGTTCGTGTTTTATTGACACG
ATCTTTTGTCTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATTCACTGCGGAATTGTGGTGATCCGTGTTCAAAACACCCGGAACGC
GCCTTCAGATGTCGACCTCTGACCACCCTGAAGCAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAGAAAATCCTTCGGGGTTACGTCCATTCGTT
TACGAATTGAAGCGAATTCTTGCCAATGGTGTAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCATGCGC
CACCCACGCCTACCAACCTTCTTAGAGTGTATCTCTAGTTTGACGGGGGGAGGGAATCATTCGAGCGAACACCAACTCGGCTCTCACTCATCACGTACTG
ACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGACGAGGAAAGTAAGAGCGAGGATGCTCTTACCACCCAGGTCACTGA
TCTTGCCACAGTGCGCTCCAAGCGCACTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCCCTCGAAACGGTTGTCCGTTTCGTGCAAGAT
TCCATTGCAGAAGCAGTGAACCGACAAAAGAAAAACGCAGACAAGAATGGAAGGGCAAATGTTCTTTCATTTAACGAAGGTGACCTAGTCCTACTATCTA
CGGTAAACTTACCTTGACACATATTGACTAACGTGGGTAGTAACAATTTACTTTCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCTGCATAGGCAACGC
ATACACGATTGAACTGCCTCGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGACCTTATC