Description :
From Genome Similarity Track
Location :
contig_93:58836- 60914
Transcript NameFunction/comments
g10771.t1hypothetical protein
g10772.t1conserved hypothetical protein

Sequence
2078 bases(100 bases per row)
CAAGGCTCGTAGCGCGACTATGCGCAAGTGCCTGGTGAGCGGCTACTTTGCGAACGCCGCCAAGCTGCATGCAGACGGTGTCTACCGTACGTTGCGGGAC
CAGCGACCCGTGCAACTGCACCCAACCTCCGTGTACTATCACATGGGCACGCTCCCCGACTGGATCATGTTCCACCAGAGCGTGCTCACCACGGAGGAGT
TTGTGCGCGATGTGTCGAGGATCGACCCTCGTTGGCTTGTGGACCTCGCACCAGATTTCTACCGCGCGAAGGAGGTCAGCGGTGCAATATCAGGCAGTTC
CGGTGCACTTGGCTTGCCGTCCACATCGTCAACGATGCCCAAGAGCAGAAACAAAAGACGAATCTGTCAGAAGCGACACGCCGCCTCGACGAAGCAGCTA
CCGGCGGTGATGGTCGCATCCTGTTCGGAAACCGACGCGCTCCGCGCAGGACACGAAATCTAAACTGCCCGTGCACATCGGCAAGAGCAAGGGTGGGTTG
CGGTCGCAGTTCTAGTTGTCCACCATGGATGCCATCAATGAAATATGGAGAACACGCGATTTCTTCCCGTCACGAAAACGTTCATTACTATCGATACAGC
TACTGTGAGTTGTACAGGCTCGCTACTGATGCGCCCGCTCTCCGAATTGGCTGTCGGAACCTGCGCGCAGTCGTCGAACTTCCAGTACTCGCATCTTCCT
CTGTCGTCGCTCAATGGACTCTCGTTGGCGGTCAAACACTGGCACGCTGTAATCCTGCAGCGACACGTACGACGAGCCTCGCTGCGAAATCTCGCTGGGA
GCGACGCTCAGGAACTCGTCCAGCACCTCGCTGGTCTTGGTGGCCGGGTGGCGAATAGCTAGTCGCAGGATCTCTTGGAACCGCTTCTTGCGCTGCTCCA
CCAGCCGCACGTCGTGGCGCTTAAGGTAACTCCAGACGCCTGCGCTGGGCAAGGCCGGCAACGTGACTGTTCTGTAGTTGGTATTGGACACTGGTGGGGC
CTTGGTGAGCCGCGGCACTGTGAGGGCTCAGTGGGATGTGGTTCTCCGGGCCGTCGGGGGACGTCGCTATGCACGCTTCCAATTGGACGCGGGACGCCTG
ATACTCGGCCAGCAGGCGACTCAGTTCGCTGTGGAGGTGCTTGAAGGCGCGGAAGCGGCGCCGGATCGTGTACGTGGAGAGAAGCCCGTCAGGGCCTTTG
ATGTCCACGTGGTACATGACGACGCCCTGGTTGTTGATCGAGTGGTTGTTCACCTCAACGGTCACGCCCTGGTACGGGTCCATGAGGCCCGTGGGTGTGA
GTAGCTGGCTGTGCGACGCGTCATGGTCCGCATCGACGCTCCAGAAGTTGAGCACGTCGAAGCCGCTGGCCTCGCTCGTGTAGCTGTCGCGGATGCCGAA
CGGGTCATTGAAGCCGGTATACGGCTTGTCCAGCGCTGCGAGGCTGCTGCGGTTGGCGCTGGGCGGCAGCTGGAACGACTCTCGAAGTGCTCGGGCAGCG
CCGACTCGCTAAAGCGAAGGCTGTGGGGGGCTACGACGCGCATGAGGTCTGAGTCTGATTCGGCACTCACTTCAGGGTGAGACTTGTTCTGTAGGGCGCA
AAATGCGGAATGAGGAGGGTTTCAAACTGGCGGCTGGTATGAAATACGCGGTCGAAGCTGCTCGCAAATCGACAGGTGAGTGTCGGAAAACAAGTTGCTC
CAGTTAGCAACGCTGCAGCGACGACGTACCGAGTAGTTGTCGCGTTAGGCAACTGGGAGACAACCCTCACTTAGGGCAATGATAACGATATTAGACGACT
GCGAAGCGAGTCGAAGGTCGAGGCCGTTCGTTTGGAGAATGATCAACTGGAGAATGATCAACTCTGGGTTGCTGGTTATTTTGCTGGGGCATCGCAATGC
GGTTTCTCTTCTCCGAAACGACGGCGCGCGTTGGAGGAATTAATCTATTCAAGTAGATCGAAGCCATTTCTTTAAACGGAAGTAGATTCCAGTGACTACT
TCAGCAAAACCAGGGCGAAGTCAAGCATTCCGAATCCATCATGCAGCACTGGCCCTGTAGCGCTAGGATCAAGAGGCA