Description :
From Genome Similarity Track
Location :
Scaffold_145:588354- 598251
Transcript NameFunction/comments
Aphin_H310_10910folic acid synthesis protein fol1 putative
Aphin_H310_10911flagellar associated protein

Sequence
9897 bases(100 bases per row)
GAGTCGAAGTTGGATGAATATTCATCCATTTTCCACGAGCGTTTGCTTCATCGATACGTTGTGCAGACGGCTATACACCGTCTTACACGGAATCCTGTAC
TGTGCGGAGTTGCTAGGCGACATCGTGGCAGGTCGCCCAAACTGCCTTCCACTGAATTGTTCAAAGATAGAGAGCCTTCTATCGAGGCACTACATACCCG
TTCGGCCATATGAAGAAGACCCACCCTTCAAATATCTACTGCATGCCAATGCAATTGCATCGGGTTCGGCGGTGGCGCGTGGACATGGTACATGTAGTCG
GCATGTGAGTGCAGCGTGTATGTAGATTGCCGCTCATGCTGACTTCGTGCGTAGTCATGGACGAGGGGTTGGGACTCTCACAAACTCATCAGTACGTCTC
CAAGCACAATGGCATACTCAGCGAGGAACCGCCGTGGCAAGGCGCCCGTCGACGTATCACATATTTGCAAAGGTAGACAGGAGTCATGTGTGCAGTGCCG
AGTCACCTTTACCGGCAATGACGATCAGCGCGATGGTGAGTGAGATTGGCGTATGCCACTTGGTGCTGATGGATCTGGAAGTCAGTGTAAACAGGGTAAT
CAATGCCCTTGCGTTCGTGCGTGGCTACGTGTCGCACCGGCGCCGCGTTTGTTTGACAGGATGCGAGAAAACGTGGCAGTGTGGCGTCGTTTAACTCGTT
GCCGCGGAGTCTAGCTGCACCGAAGGAGCGGCATTCGATGAGCAGGGGTGGAGTTATCTCTTGGTGACGCCTCGGGGTGTTTGGAGCCAGCCCGAGCAAG
CTCGGCCAACGGCGCATCCTTGGTGTGGCAAGCCGGCGCTGCTGTGTCTCTAGCACGATAGCCATGCCTGGCCGGTCTTGCCAACCTTGAGGCACAGCCA
GCCAGTGCCACCACTGGTCGGATTGTCGAGCATGCGCATCTTGAGCTTCCGACGCTTTTGATTGGCTCGTGGGCCAAAATTGTCCGATTTGATTGGTTCG
TTCAGGTTACGTTCATGTTCAATCAGCAAGAAAGCTCTCATTGGGATGGCCACCATCGCATCCGCCGCCGACGCCGCCGCAGTGACGGCGTACGTCGCGA
TCGGCACCAACCTGGGTAAGTCACCTGGTTCGATCTACTTGTCTCACATGCCACCACGTCGTGGGTGCTCCGTCCTTGTATCTCATCACGCGGCTGCTAC
ATCAGGCAACCGCCCCGGCAACCTCCATCGCGCTGTGCAAGAACTCAACCAACATGCTGGTCGCGTGGTCCGGACGTCGCTGCTGTACACGACATCGCCC
CAGTACGTGACGGACCAGCCTCAGTTTCTCAATGCTGTGCTTGAATTGTCGACGACCCTCAGCGCGACCGACCTCCTCGTTGTACGACGTTGTCCCTTGA
CCAGAGACCAACCATACACGATTGACCCATGATGTGCAGTGCTTCAAGGACATTGAAGTCCGCGTGGGTCGAGTCCTTGGAACGCTTCGGTACGGCCCAC
GCATCCTCGACGTCGACGTTCTCTTCTACGGCAAGCACATCATCGCCACGACGACGTCGGTCGGGCCGCTCATTGTGCCGCACGCATTGCTCCACGAACG
AGACTTTGTGCTGCGGCCATTGCTCGACATTGCCGCAGGTTTCGACCATCCTTGATGCTAAATCGTTCGATCCGACGGCAGCCTCTAGACTTTGTCCACC
CCACTTTACACATGACCATCCAAGACTTGCATGCAGCCCTGCCACCATCGGCAAACCCGCCGCTTCCCGTGCTCAGCCTGGGCGTGAACGATCTCATGTG
GCCCCTTCACACCAAGGTATCGTCGTCGGCATGTCGTCGTGCCAGTCGTGACCTGTTCGGTAGACGTACGTCATGGGGATCGTAAACACAACTCCAAACA
GCTTCAGCGGCGATGGCACAGGCGTCGATGTGGGTGCAGCTCTAGCGACGGCCATGACCATGGTAGACCAAGGCGCGGATATTCTCGATGTCGGCGGGGA
ATCGACCAAGCCCAACGCACCCGCGGTGTCGGTGGATGAAGAAATTGCGAGGGTGCAGATGCCGACAAAGACTATTAGGGCATGCTTCTGACCGAGATGG
TTCGTGGCAGGTGGTCCCTGTCATCCAGGCCATCCGACACGCCCTCCCGCCCGTGCCCATTTCGATTGATACGACCAAGGGCCGCGTCGCAGCCGCGGCA
ATCGAGGTATGTCTCTACTTCTTGATGGACTAACGAAGACGCACTTGTGGCCGTGTCATGCGGGTAGGCCAGGGCGAACCTCGTCAACGACGTGTCCGGC
GCAACCGCTGATCCGACGATGCTAGCCACGGTCGCCGCAGCACAAGTTCCGGTGGGTGGATGCTCTGACCCATGACATCGTAAATTGGTATTGCAACATC
GTGCGCTGGGCAGGACATTTCGCGTTGCTACGGCTAGCGAGTTGGCTCGCAGCGCCGCAAATCCGTCTCTCTTGTGACACGTCTGTGTGCTGTCTCGAGG
TCAAGTGTGTAATAACGTGCCTCGCGACTGTGGTTAGATTGTGCTGATGCATACTCGAGGAACGCCGGCGACCATGGCGTTGCAAAAGGTAGCGCACCCG
TGCCATCCACTGCAGTTGCGCGACTCGAGTGGCTTGTTGGCTATAGCGCTATGAAGATGTGGTTGGGGACGTGGTGAAAGAGCTCCGGCCCAAGCTCGAC
GCCGCCATGGCTGCGGGAATTCCGACTTGGAACATCATAGCCGACCCGGGCATTGGGTTCGCCAAAGGGCTTGCCGAGAATGTCAAGCTGCTTCGCCATA
TCGATCAGCTCAAGGTGGCGTGCGCTCCGTGCCCGCTGCTGGTAAGACAAGCTACCATGTCCCTCATTTTTTGATGCGTGTTCGTATTGTGTGCAGGTTG
GCGCGTCGCGGAAAGCATTTCTCGGCACGTTGTGCGGACGGCCAATCCCGGCCGACAGAGGAAGCGCCACGGCCGCGACGTGTGCGGCGGCGATCGTTGG
TGGCGCCGACATCGTCCGCGTGCATGACGTGGCTGTATGTGTCGATACGTGCAAAGTGTCGGACGCGATTTGGCGGCCGTAAGAGTCGTTGAATCAACGT
GCGCAATGCGAGCGTTTCGATGGACGACGTCCATTAGTTGCGCCGAAGAGTTTCGCCCGCAGCATGCCATCCAGTTCGTGAACGAACGATGGATGAGCGT
TGGGGAAATGCTGGAGCTCGCGTGTTCAGTGCCTTGTACGCGCTGCTTTGATGCAATTCAATCCGCGAATTGATGCCTTCGTTTGGCGTGATCGAGGCCA
TCCTCCGCGATCAGCGACGCGTGCGCTCGGCAGCAGGTTGACGTTTAGGACGTGTCCCTGCTATCTTACTGAGTCGCGACGTGCGGAAGCCACCCGCTGC
ACCAAACTCGCGTTAGAAAGGCATGGGTATCAGAATGGCAAGGCAGGAGGCTGGCACCGCGTTGGGGAAACCACCGAGTGCAGCCAGCAAGGCGAGAAAT
GTAGCTGGTCTTTCCGGTGCATGGAGCGTCATTGGGGCTGCTGCACACTGCCGTTGACACAAACGCTCTCAGGCAACACGCACGGTGTCAATCCAGATTG
AAAAGGCGGGACTATTTTTGCCACTAGCAACGGTTCATGCGTTGGCTTCGTATAAATATCGCCTCGATTACGCCGTCACAACGCACAGGCAGGATGGAGT
CGGACGGGGAGGTCGATGGTCGCGTCTCGACGCCCCAGCGCAGCTCGGGCGTGCCGCAGACGGCCGGGGACGACGGCGCGGCGGTCACGCCAAGCTTTGC
CATGATGTTTTCCATCTACGACACTGGGCGCGGCTCCATCGCGACCGAGCACTTGAGCGCTCTCTTTCAAAAGATGGGGTACACGGTGGCCCGCGACCAG
CTCGAGAAATTTCTCGACGAACTCGACCCCGACGCCACAGGCGACATCTCGAAAGTACAACGATCTTGCTCGTCGCGGTGGCACATAGTGATCGATGCCG
TAGGTCACGTTCCTCAAGTGGTTTGAAAAGTGGGGCGATGCGCTGGACGACCCCGAAGAAGTTGCGGCCCATGTTGCTGACAACACGTCTCCATTTCGCG
ACAATGACGGGAATGACGAGTGCAGCACGTTCATGGCGGACGCTACGTCCATCCAAAGCGCCATGCTCGAGGCAAAGATGCAGCGAAAACGGGCCGAAGA
GGACGTCCAGCTGCTGGCGAACCGTCTTGCGCATCTCCGGTACTATCGCTCGAACGATTGGAATTTTTCCAGTGTGCATTGTCTCGTGTACTTGTGTAAC
GAGGTCTCGGTGGCTCGTAGGACGGAAGAGAAGAAAGCGCAGAAAAAGATCGACGAAGCAAACAAGCGCGCCGAGGACATTGAAGCTATCAAGAGACGAA
ATGCCGAACACCAGCGCCTCAAGCGCGAACATCTCGAGCGCACGACCGCCAGTGTTCGCCACACCCTCGTGACGAATTGTACGACGTAGCACCGATGCGC
GTGGGGGGTTGACGAAGTTGTGGTTTTAGCGAAAGCCAGCATCGAGTCGTGTAAGAAGAAGGAGCAGGCAATCACAGCTATGGTCAAGCAGCGTGCCAAA
GTCGTGCAGGACACCAAGCTCGACGCCAAGATCCTTGCCGAAGAAAAGGCACGGCAACTTGAGATCGAGCGAAAACGCCTTGCACTCAAGACGCAGGCGA
TCAAAGAGAAGGAAAAGGAAGCAGCTCGAGTACGGGAAGAAGCGCGAAAGCGGCGGGAGAAGGCACTGGAGAAAGCGGCGCGGACAAAGGTAGCAGACGA
GTACAAGAAGAAGGTAAGCTGCATGCACTGGTCGTATCAAGAGGGCGTCGTCAGAGTCTGTCCATAGAGTGTCGCGGAAAAGATGCTGCGGGACATGGAA
GCAGAGGAAGCGCGTCTCATTGAGAAACTTCGTAACACGCAGGAACACCAGCGCCAAGCATACATGCATCTCGAGAGCGCGATTCAAATGCAAGTCGCAG
ACGACTGACGACGGAACAGATGGGAAAACTAATTTTTATTCAAACTTCAATATTTTCTCGAGTAAAATGCAAAAATCGTAGTATCATTTTGCATGTCCAA
TATCAAATTTCAGGTGTCAGTCCCCCTATCAGTGAATTTCCTATGAATGGATATAGGAATGCAGTATGAGCACGTATCAAAATTTGAAGGTTATTCGGCC
TGCAAGGAATTGTCAGAATGGTGCTAACGTCGGCTCTCAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN