Description :
From Genome Similarity Track
Location :
Scaffold_13:58832- 78051
Transcript NameFunction/comments
Phyke_g923hypothetical protein
Phyke_g924cytosol aminopeptidase, putative
Phyke_g925hypothetical protein
Phyke_g926hypothetical protein PHYSODRAFT_356191
Phyke_g927folate-Biopterin Transporter (FBT) family
Phyke_g928hypothetical protein PHYSODRAFT_566444

Sequence
19219 bases(100 bases per row)
GCTGCACCCTTGCTTTTCTGCGGGGATAAAGATGTGTTGGTGTGTCTGCGCTCCTCAATGCACTCGGCAGGATCGATGTCAACCACTGCATACGGTGTTG
GAGAACGTGAGTTATCCCGTTTTTTTAGACCAGAAATGTGCATTATTGTCACCTCCAGAATCGCATCTCCTTCCAAGTCCAAGCTACACCGAGCCTGAAA
ACCTCCATCGGACGCTGCCTTCAGGTGATGCGCGCGATAAATTTGAGTGTTTAGATAGTGGATACACCCATTAATCCCATAAAACTGCGGATTGCGTGCC
TGGTAGTCGATCAGGGCGCACGGGATTCGCGCACCATCCAATTTGCAAGCAGCATCATGCAGCTGATGCTGTGCGTTCTCCAATTCAAGCTGTTCGACCA
ACAGTTTGCGCGTTTTCATGTCTACTTCCTTGATGATATTCTGTTGACGAGATCGCTCGCTTGGTCTCTCTCCAATCATCCAGATTCTCAATTGAATCTC
ACCAAGGTTTTCGCAAATTTCCATCCCTGCCTCTGATTGTAATGCATGCCACTCAGTCCATTTATGAACCGAAAGTTGGTCTAGACTGATGCACACGTAC
CCAAGCGGGTTGTTCAGATTGGAGTTGCCATTACCAATCACTCTTACTTTGAGGCTGCACGCGAGTTCAATAGGACAGACCAAGCCAAAAACATGGTGTT
CGTCAGCCCAACGTGGGTTGGATGCCTGATGAGCTGCGGCTGTTCTAGCGGACTCGCCTGCAATAGGCTTTCCACGATCATCCAGTAATGTTAGCTCGCA
GTAGGAATCCGACGTGTTGGTATCATCAGCGCTGAAGAGTTCCTTTGCAGCTAGAATAGTTACCTCCAATCGGTTATCCGTGTGTTCGGTGGTCGCCATG
GCTACAGGCCTCGTCGCCAAAAGGTCTGAGTTGTGGAAGAAATCAATTAGATTTGGCCCAGATATACTCATCAGGACATGAAGCTCTCCCCAGCCCTGCG
TGGTGTGTTCCTTCTCTCGATTTTTCAGTCGGTTTTCATTACGTCTAGGCGATGACACACGGACGGCTTTTGGAGGAGGTTCTACACGGAACCAGTTGTC
AATAAGTTCCGACTGACCTGTGTTTACTGGCGGCATGCGGAATTGGGAAAATGGCACCCGAACAGATCCCAAACTGTCATGCCTTGAGAGATTGTCGTGG
TCCCATAAATCAAACTGAACAGCTTTTATCGAATGCAGGTCAACGACCCTGCCAAGCGTGAACGATTTCTTCCAAACGGGATTGAGTGTAGCATTGTTCC
AATCCGTACGCTTCTCTTCCGTGTCGATAATCACCCCATCCTTATCCACGAGCTTCACGACACAGTAAGGGTCGCTTTTTCCGTTTGGGTCAGCAGCGCG
AAGTTTGCGAGCTTCCTCCACAACTAGATCAAGGAAAATACGAGTAGGCGCAACAGGGGGGGCAGGAGACGCAGGTGGTGGTAGGGCCGTCGATTCCACT
GTAGAGGTCGGGTTCACTTTTGATACCTCGAGAATTTGCATCCACTGGGCTACCTCAGGGGTGCAGCAATATGCATTGTAAATTGCCATAAGCCATTCGT
GTTTATCCACATCATTTTCTGCCTGGATGTACAGGTTGGGCTGGTCAGACGCTGGTTGAAGAATGATACACCGCATGTAGCCTTGGTCGTTTGACTGGTG
CACCTTAGAATCTAGCGTCAAACTGTAGCGGCGTCTCGGTGTTACTTCATGCGGTGTTTTGAAGTAAAGCAATTCGGTGTGCGATAAGCGGAAGTACCTC
CGCCGCCAGTTTGGCACGACTCTCCCCACACGGCTACGCTTCATCAGCCACCCCTCTTTAATGTATTGGTGGTTGCTCATCGTCGGCGGCAGTCCACGCG
AGACAACTTTTCCTTTCTCAATGGTTCTGCTTTCGTCCTTCACAGCACATCTATCACTGTCATGCGGCACACTTTCTCAATATCGTCAAGAGTCGCCGTA
CTTTTTTTATCAAGTGCCGCTTCATCACTGTTTTCGTAGGGTCAAAAATCCTGACGCAAATCCATCCTGCGCTGTCAAGTATTATCGTCGAGAACCTTTC
TGGAAGAAAAGCGGTGGGGGTAATTCACGGGAGAACAGCAAGTCACTCTTGGTAGCTGGAGTTCGAGGCTGGAAACCTCGGCTGTGCCCTTCAGCTGAAC
GGTGTCGGACTGTATCCTTCCGCCTTGTATTGTTCGTACGCTGCGCAGTCGGACTAGAACTTCTGGTCCGTATAACTCTATTATTCCCGTGTAGATAGAT
GCCACCATTATCACTCAATGTCAAGGATTCCGAGACCGACTTCGTAACATCCTCAAGGAGCATATCCTCGTCACACTGGACGCTTGAGTCCATCTTCACC
TTTTCTTCCTTGTTCACCACTGTCACCAGTTCCTCATCAGCTACTTGATCCTCCAAATGAATCTCTTCAGCATCATTGTCAACTGAAGCACTTACAGCAG
TTTGATCAGTCTGTGACTTTGAAGCAGGAGCCTGCACACTGGGACTCGAAGGCTGCGATTTACTCACTTGAACACCCAACGCATGAACCAAATGTGGGGC
CAGAGTTTTCCCCAAGCACGATAGCGTGAGAACTCCATCCACATGACCCACAGTCTGATTGTGGTGGTCCCTTAGATCCCACCGTCCACTCTGACTCGCC
CACTCGCATACACGATGcagcatgctgctgcttagTACATCAGTCTCTGATTCCAATAGTAGCCCCACATGAAGAGCCAATGAGATGTTCGCGAAGGCTC
CAAGTCTTGCTCTGCCGTGGTCCTTGGTTAGTAGTAACAAAACCAACGGAGCGTTtctctcctgctgcagttcgcgTACCAACTCGTCTGGGTCCGCTTC
AAACAGGCAGGACTTGCCATGTCGAAGCTCTGTCACTGCTACTTCACTGGTAGCGGTGTCTTGATACTGCAACGACGTATCGAATAGAACGATTTCATAC
TGTAACAACTGGAAGGCCAACAGAAGCGCGTCAGTAGGAGAAGCTGATGGCTTCACTGTGGTGTTTAGACACACACGATCGACGTAGAATTGGAGAGAGA
AGAGTAAGGAAGCAGGGCGATCTACAGCAGGcgtgatgaagatgctctGGTCCACAGAGAGCAGCGGCGGAGCGGTGTCCTCGGCGACGTCCTCGGTGGC
GTCGTCTGTCATTTGAATGTAGTGGCACAATGCGGTTGTCACAATTTCGAGGTTTCATGTATAGTGACATATGCCCATCATCTTTCAGTAGGTGCTGGAC
CGCACATTCCACAAGCTCACTTGACTGTCATAATGCTTCGTCGCTTCctgagctcctccagctccgcctccGTGGCGCATCGcatggtgcagcagcgtgt
ACAAGGCCAGTTGTCTCTCCTCCCGAAGACTGCTGCGTCGCCCAAGACTcgtgtggtgtttgtgctccgtgctgctgcctcggATCTGCAATCCTCACTG
CCGTTCCCGgtttctgcagctgctctACGCGACTTTAAAGCCAAGCCACAGGAGAAATTGTACCTATATCCAAGTGTGGACGAAGTAGAATTCGCTGACC
AGCGCGTGCTACTTGTGGGACTCGGAGACACCGATAAGATCACGCCCAATGTGCTGCGTGACGCTACGCACGGAGCTCTCAGTGCTTTGAAGACCAAGCG
TGCTAAGGAAGTGGTGGTACAGGTGCCTCAGCTGGAAGGCAGCAATTTAAATGCTGCGcgtgtggtggagctgctgtccCAGGCCTCCGTGCTGTCTAAC
TACCAGTTTGACCAGTACTTGAGTGAGGGCAAGGACGCGTACGGAGACGATAAGCTCCGTCTGCCTCTGGAGCAGATCTATTTGGATACCTCTGCCGAAT
ttcagaaggtgatgcgtTGCAGTAAATGAGGTTTGGAATCTCAAAGCTAATTCTTGTTGTGATTTTGTGTGCTACAGAATGTGACGGAGCAAGCTACGGT
TGGAGAGGAGACGGTCTTCGCACGAAACCTCGGTGTGTAGATCAAATGTTATTACAATAGCATTTTACTCGGTATTTCAATGGGTTATTGACGGTATTTG
TTGTGTCGACTCAGGTAATGGGCGCTCGCACATTGTGAACCCAGCGTTCATGGAGGAGATCGCGCGCGCTTCGGCTGATCTTCCCAACATGTCGGTCCGT
GtgctccagcaagaagattTGGAGAAGGAGGGCATGAACTTGTTCGTGAGTGTGGGCCAAGCAGCTACGTGCCCGCCTCGCCTGGTCATTCTTGAATACC
GTGGAAATCCGGATTCGGAGGAGAAAATTGCCCTAGTGGGCAAGGGCATCACGTTCGACACGGGTGGCTTGAACCTTAAACCCACCAATTCCATCGAAAC
CATGCACACCGACATGTGCGGTTCAGCTGCTGTGTTGGGAGCTGTCCGTGCCGCATCGCGTCAGGGACTGAAGGTGAACATCATTTGCGCCCTTGCTTTG
GCTGAGAATGCCATCGGATCAAAGGCTGTTAAGCCGAACACTATCGTCAAGTCCCACAAGGTATGTCACAGATTTGTTAGGGAACTTTATGGATCGATAT
TGACGCATGTTTTTAATGCAATTCAGGGTATCACTGTggaaaacaacaacactgATGCAGAGGGCCGTTTGGTTCTTGCCGATGCGATGTCGTACGTCCA
AAAGGAGTATAGCCCCAAGAAGGTCATTGATGTGGCTACGTTGACCGGCGCTTGTTTGGGTACGAATGCTTTCGTTTGCCCTAAAATGTTGATGAAAATA
TTTGCAAGGTGCTGACCAGCTTGTCTGATCCGGCTAACAACAACGTTTTCACAGTTGCGCTGGGTGAGCAATGCGCCGGCTTGTTCTCCAACTCTGATGA
ATTAGCCAAGAACCTGCAGGTACGGCGATCTGTTCAATGAATGGACGTGGTATCAATATTTCCGATGGTTGAACGGTATTTCACATTTGCAGGAAACGGG
AACTGATTGTCACGAGCGCTGTTGGCGTCTGCCAATCCTCCCCGAGCACAGTGCTTCTCTCAAGGGCACGCAATCAGACTCCCGCAGCACGAGCCGCGGT
CGCTATGGCGGTGCCTGCACGGCAGCAGCGTTCCTACAGCAGTTTGTCTACGAGGGCGTCGACTGGGCGCACATCGATATTGCTGGACCGTCGGATTACA
GCGCTGCCAAGTCTTATTTCCCCAAGGGAGCCACGGGCTTTGGCGTGCAGCTGCTCTACAACTACCTCAAGGAACACGAGCAGCATTAGATAAATGCAAT
GTCTGCCTCATGCGCTTCTTAGCACAAAGGAATAAAAGCGGCATGATTTTTGAAGTCCTTGCATTGGGGGTTGGTGCTACTGATAAAATCACAGAAGCTG
GTGCTAATTGTCCATCAGGTTACGGTCATCACTTACCTCACTGATCCGTGTAGACATTCCAGACGAAAACACAACCGTCGTCACCGACAGAGACGAGTTG
CCGGTCGTCTGGACTGAATGCTAAACCACGGACATTACCCGAGTGCCCCACGCCATCCATGATTAACTGGCTGGTATTGTAGTCCCATAATTTTACCAGT
CGATCATTTCCCCCGGTGGCAAACACGTCGAGGTTGTGTGCTACGGCGATGCATGTGGCTTCTTCCTCATGGGCCTTCTGAATCACAGTCACGGGCGTGT
CGATGCGCAGATCCCAATAGGATATTCGCTTTTCCTGGCCGGCGCTCAGCACTAGGCGCTGGTCGGAAGACAACGCTACAGTGTTGATTCCTCCCATACG
TTGGATGTGGCTTGAAATTCTACGTTCGCTACGTAGGTCCCAACACAGCAGACTGCGATCCCGACTGCAGGAAATCAAATGCTGGTCGTCGCGATAAAGT
GCCAGATTCGTGACCGTCATTGAATGTTCCTTGAGATGTGCAACCAAGTCACGCTTGCGAACGTCCCACACGCGAATTTCGCCACCTACGCCTGCAGACA
CGATGAAACGTTGGTTGTGGCTCAAAACGAGCGCCGTGACGCCACCCGTGTGTGCACTGTCAATGGACCAAGCCAACTCGCCAGAGTCACTCCCATGGGA
ACGGATACAGCCATCACTCCAACCTGATAAAAGCACATCCAACGAAAACTGAAGGCATGTTGGTGTTCCTGCGTCTCCAACGAAACAGCGTGTTACCACC
GAGTAGTCAGAGGCATCCCAGACCCGAATGGTACAGTCTCGGGAGATGGTGGCGAATCTGTCGGACACATCTGGCGCATATGCGACTTGTATTGCAGCGT
TGGAGTGGTTTTCAGACAGTAGCCTTGGCTGGAGGCTGTGCTGTGAAGCACCGAATGCAAGACGCACCGAGAAAATACTTCCAGCTTGTGTACCTGCGAC
AGCCTCTGTCTTTGCAGCGTTGAGCGCTAGACCAACGACACCGCTATCAAGCGCGACATGACATGTATCTACGAAGTCGTGGCTATAATGCAACACGCTG
CCGTCACCACCTCCAACCAGCATACCTCCATCGAAGTACAAAATGGAGTTCACACCACAGGAACATGCGGGAACGACTTTGAACAATTGCCGTGTCTTCA
CGCCTACTACACTGAAGTCACCACTGGAACTGCCAGCTACGAGTGTCTCGAAGTCAGGAGAGAACTGCACGCAAGTGTAATCACGTACGAGCATCTGCTC
GATCTTGCTCTGCGTGAGCTCTCCAGTGACAGGATTGAGGACCCAAATCACCAGCAATCGGTGACCCACCGTTGCAAACTGATAGTTAGCTGTATCACGG
CGCTTGACATCGCGCGCCATGCCTCCGAACGCAACTGCTGTGACGATATTCGAGATCTTCTGGTGCGTCGCGCAGATGTTGCCTGTCATCACGTCCCAAA
TGTACAGCCGTGGTCCGTCCTCCGGTGACCCCACTGAGCATAGTAAGCGCTCATCATCGGAGAACGCGAGTGCGGCGATACCTGCATCATGCTCTGACAA
ACGAAAAGCCAATCTTCGAGCGGAATAATCCCACACAAGTACATCAGCTCGCCTGCCACGTTCACCCGAGGCTAGTAGCCTCCCTGATCGTGACATCGTG
ATGCATGTTACGTGACCTTGATGACCACGCAAGAAGAGCTGGCTATGCGCATCTTGAAAAGACGTTAGAATCACCGACCCGCCGGCTGGATACACGTAGT
CACGACCAGATGGATGATAGTGGATTGCATTTGGTATAGCGGAGAAGCCGATTGTGTGCTCGAGTTCAATTGTCGAAggagactgcagctgcttgttgtC
TCTTCGACATGGCTCATTCGGTGCGGCAGTGAGGCCTCTATAGACCGGTGCTCCATCCATCACAGGAGTTCTTTCGTAGCCATGCGAGTTGTTGCCACCA
TCGTACTGCATTACGCGTGAGGTGGCACCGAGCGAATTCTTGATGCtgtcagcagcaaagtgAAGGGGCGACACCAGTTCCGACAAAAAATAACCGTTGA
ACAAGTAAAACACATATATAAAACACGCCAATTGCTTACtcgagcagtgctgctgactCAAGTAGCCCTGTGGCACCCACGTAGCTCAAACAGGTATAAA
ATGGCGGCAAGTCGTTGTCTTGCATCCATTGTGCAACGTCCAAGCCGATGTCCTCCTGACGGTCGAACAAATTCACCCGCAACATGCCTCGAGACAGAAA
AACCCGACACGGCAGGTTGAACGTTTGCATCTACGTAGACGATGTTAAAGCAGAGCAAGACATAATACGTATCAGTGCGGTAAAGTGAACCTTTCTTCGT
TACTATAGACCGGTACCTCCATATCCTTGACGACGTTGTATTCCATGGATTCGTAGACCAATGTGCCAAGTTTCCCGTCGTCTACCAACTCGTACAACGC
AAAAGACAGTCGCTTTGGGGAGTAGGTTGGGCTACCTGGGTACCAAAACACTCGATAGGGAACAACCTGCACACTGTTCACGAGAGAATTCTCCCACAAG
TTGTAATCCAGATAATCCGTCGTCGTATGCgaccatgttgaagcactAACATGTCATCATAAAGAAGAAATCACCATCGTTAACAGCATACTTCGGTCTT
CGTTGCAGTCAACCAAGTCTACAATAAATACCTGCTCCAGTAGCATGGCCGACCTCTAGCACAACCGCAATCCCGTTGCAGTCTGTTAGCAATTGCTTCA
AAAGCCATGGGGTCATCAGCCGCCACAGTGTTGGTCAGTAGCGCCACTCCAATGCCGCAATGCGACCTGGTGAGCGTATTCTCCAACGACTCGTTCGTAT
GATCGGTTGATGAGCATTCTACACAAAAAACAATAACAAAAGATAGAAAAATATAATCAAAACATGTTTGTAAGCTGAAGGATTCTTCGTGGAAGAAAAT
CACTTTGCAGACCTCGCACTTGACGCAGTACTGAGAGTTCTTCCCCCACGGGGCTCTGAGTCAACAGCGTTAGACGCTTCCAATCTGCATGGTTTCTGGT
CCGGCAATCGCCACCGTACAGTGCATAGCGATGTGTCAAGACCTGCCACGTGTCTACAGTAAAACAGGGGCTTTAGTATGAGAAGAATTAAAAGAGAAGA
TAGAGAAAAAAAAGCTCACCGAATTGTACCATGACGTCCTGTACATGGCGACAGACGGACTCtagttgcagcagcgtcgagtGGTCCGCGAACTGCAGCG
TGGCGGCCAGCAGGTCGCAGGGTAAGTCGCATAGCCCCATCGCCAACTTGCTTCACGTAGAATATGGTGTAGGTTCTAGACAGCAGTAATTCTAATCTGC
AAAGTTGAACCTGCACTAAAATTATTTTAATTTaaaattgtttttttttatggATAAACAACCTGTGACTGGGTTTTTCTTTTATTCAACTGCTTGCATA
CATTGCATCTCCAATTGTAGTTAACGAACGGACCTACATTTTATACACCTCGAGTGTACGAGTGACTCTACTCAAATCTACGGAGGACCGTCATCTGTAT
TCCACCGCTTCAGCTCTTGGCGCAGCATGCGCTGGAACTGCGACGTCGCAGCTCGCTCCTTGTCAATCTCCACGCGAAGTCTCTTCATCTCACCTACAGC
ACGATACTTCTGCAACGACTCGCCCACTATGTTCAGAGACTTGCTACCGAAACTCCGCTTGAAACTCTTCAACGAAACCTTCACCGgcaacttcatcttg
ctgtAATCACGCTTGATGCTGCGGTTTGTAACAACAGGAAGTTCCAGTCTTGACGGCAACGGGGCATCCAGCAGACCAAACGTACTCGGGACAGACCCCT
GCCAATCGACTGGATAATAAATGGTGATATCACTCACCGTCTCGAAGAAGGCAGTGTAAATTTCCTCAAAAATCTTCCGCCACGGAAGCAGAGCATCGGC
CTCTTGCAAAGTCACTTGATTCTCCACACCACCCTTCGTCAATTGCTCGTGAACCGGGAGTAGACAGCTGTAAATGCGCTTCTTTAGCTCGTATGTCGAC
ACCGCTGTAGCTGCAGGATATGAGTGAAACAGTCGGTCAATGAAATCGACAatcttgttgaagtagaCATCGCAGACATGCTCGCGTTTCACAGCAAAAT
TGGGGTTCTCGACTGTGACTCGGGTGACCTCCAGCGCTGTTAACACCGCTCTGATTTCATGTTGTTTTTCCTGTGAGTTCCAACCATGCGGAGGTTCCAA
ACCGAAAAGCTGCAACTCAGGAGGCAGGTACGCAAGGTCCATAACGCCGGATGACAAAATATCCTGTCGTACTCGGGGGAACACGGCGCAAATCATACTC
TGAATGGACACCAATGACTGGTACTGGTTCATCATGGCCTTTAAGCTTGTCTCCAGTAGCTCTTTCAAGCCAACATTTTTGAGAAGGCGCACAGGAGGAG
atagagctgcagttttggTAAGTGCCTGAGCAAATTTCGTCGGAAGGGAATCCTTTGCACTGATCAACTCGAAACCAATCTGAGTCACGGACGAAGCATA
TCGACTTTCCACGCGCCGGACACAACCCTCAAGATTGTTCAATAGCCCCGAGTACGGCGTTTGGACTTCCGCTGAAGCAAACGCCAGCACTACCAAAGCC
ACTCGATATCCTGGCGTTAACGATGATAGCAACCCTGCCAATCGCTGCTCCCACAAACCACAATTATGGTCTTCCTGGAGTGCTTTCAGGTCAACAGGGA
GGAGAATCGCCGATGTTGCAGCGAGTTtgtcttcttgtgcttcacGAGTGTTATTCTGCGAAAAAGTTGAATTCAGATACCGGCAGCAAACAGTAACAAC
TTGAGATGCCAACCCGTCGTTTGACTGAAAAGTACGATGGCAGTCGTGCACgggcgctgcagcatcttgggTTCCAGTTCTAACTGCACACCACAAACCG
AAGGACGAATCTCCATCCAGCAGATCAGCAATCACCAATTTCCACGCGATTGACGGCGACGCGGATTTTTGTTGACGAAGGGAGGCACTGACCATGCCAA
TAATGTCTTCGGCCTGCCAAAGCGCAGGTGCCTCTGAAGATTGTTTAGATTCCTTCGACGGTACTTGCTTCAGCCGTTTCGTACCGATCGGTGCACCAAC
TTTTCCGTTCGGTTCTCTAAAAAGCCACTGCACGCTTTCTTTTGCTTGTTGATGAGGTCGATCAAGTCGAAGCTTTGCTGCGTCAATGGCAACTGGCCCC
GAAGCATTGCCAGAAACTTGGGCATATTTCTTCCAGAGATGCAACCTAAGTTTCAGAACTGCGAGTCTCTGCTTTTCAGCGCGATGAACACGCTTCCTTT
CAGCCCGTTCCTTGGCCAATTGTGCTTGCCGCTGTGCTTCAAGTGCAGCTTCACGTTCTTGCCGTGCTCGTGCCTCCGCTAATTCCAGCTGTCGCCGCct
ttcaagctcttccgCTGCCTTCCGCCGCAACTCTTCTTGATTCCTTTCTTCTTGTAGGCGCCGTTCTTCCTCGGCTGCTTTCACTTTGAGAGCTTCCGCT
CGTTGAATTGCCACTAACCTTTCCTGCTCTGCTTttcgtgcttcttcttcgacacgcttgcgctgctcttcGAGTTCTCGCTGTTTCTTTTGTTCTCGCA
GCTGTTTTTCCAGTTctagttgctgctgtttagACACCTCGGCCTCCTTTTTAGCTCGAGCTCGTGCTATTGCCTCCGCCTTCGTCTGCTCTTCATGTCG
GGCTGCCTGGTCAATAGCAGTTTGTTTTGCCTGCTCCTGGCGAGCTTTCTCCTCTTTTGCGTGCTGTAGTTGCTGGATTCTTTGCTTGActtcttgctgt
ttcttTTCCAgttcgagcttcttctttgcaATCAGCTCCAAGTCATACCTTCTCTGATCAGGCTCTGATGATTGCTGACCAAACGTAGGCTCGCTACCGA
AACCCGTAGTGCTTTTCGTGTGTACTGGCACAGCAGTCGTAGGAGATGCAACTGGCTGCCCTTCCCTGTAGTCAACGAAGTAAGAATATGTGTCCTCATA
CTCAGGTCGATTCGGATAGAGCTGTGCTCGTTCGCTCCGCTCGAAATCTTGAATCAGCTTGCTTAGGCCTGGGTATTCATTTGAAGGATGCTCTGTCACT
CCGCGGCAAACGTCCCGTCGTAAATAGTTGCTGTATAAAAACAAAAATCAATGAGATGCACGAACGTCTGCAACCGAAGCATATACAAAACGTAAAATCC
AGCATACCCTTGCTTCATGCCGACATAGATCTTGGAGGCACGAACCTCTAACGGTTCGTTGTTGCGTCGCAATTGAATATCTACAGATAAGACAGTGTAC
TATCAGTATTAAACACCCCGAATCCACCACACATTCAATACCATTGGATTCATACCTGTTTCAAAATCACCGCCAAATTTCACAATAACTGTACTGTCGT
CTCCGTCCCCAGGACTACCTGAGATTCTCAGCTTGTGATGCTTACACACAGAGTACGCATGCTCTATGTCGTCGAAGCATAACAATTCCACCAGGTCCTC
CAACGGATAAAGTTGGCCGCGGTAAGCACGATTCATATGAAGCAGCGCTGACGATCGGGCGTTAGGGATGTATCGAAACAGTAGACACGACTGTAAGTAC
GTCGCTTGGCGCAGCAACGAGAAAAACTGGTAGTAGTCACCAGTGTGACGAGCCACGAACACTCGCATCGCAAACTTGATGTGAGGGCTTTCAAGGATAT
ACTGCGGCAGATTTTTCACATACTTCAACACATCCATACCACGACCGTTGTCCAAAGTACAGAGGATGAAATATGCGCGACACTCAGCCTCGAACGGACT
TGAGTACGCGGGATCTCCCATCTTGTTACTCTCGTCATACATTTCGTTCAGAGATTTGAGGGTTTGACCAAGCTGCTCCATGTTTTGCTGCGCCACAAAA
CTCGGAACCTCAATAAGTTCGTGCTCGCTAAGAACGTGGTATCTTGCAATACGCTCATGGACGTCAAGCGCGATGGGGTGTACTCGACCACCAGCTCCCC
GATAATTTTGTAAAACAAAATCCTTTCGAATCATGCGAAACCGATCCCAACAGAAGTTATACAAATCAATCAGCTCAGGGACCCGCGGCGGCTGAAAACG
AGGGTCAGGCCCGAACTGCTCCAGGTCCATAATTTCCTGCTCGATGTATAGTTGGGTCCGTCTAAGAATGCCAGGAGGGCGGATCTCCTCTGAAATATCC
AACTTGTGATCAGCTGAACTGCGCTGGAAACGTTTGATAATCAGCTCTCTCTCGGTACCTGGTCGGCCTGGAAAACATTTCTCGAAGACACTTAATTCCT
CAACCCGGAGATGCAATTCGCGCTCAGTTGGACTGCACATATCAATACAACACCCGTCCAGATTGGTCGCTGCTGATAGTTGTGCCTTGGTATTGTCGTC
TTGAGTTACAGAGGATGTGAACGGTGTGGCACCGGGTTCCGTAtctgcttcaacatgtgCGGTTGTTGAACCTTTCTTCATTCGTAGCTGACGGTGTTTT
CCACTGGCTCCATTACTTGGACTCGATTTAGGTGCTTTGGCACTACCAAAGGCTCCTTCGCCAGGAGACGTTCGGCTATTCCGAGGTGCCGTGTGTTGCC
CTTGGAAAGGCTCCTGTTCTGTTGATGTGTTAaatcctgcagctcgttttCCTTTGCCGGTTTTCTTCGTACCGCTCATTCGCGCTTCCATGGATGGCAT
CTTTTCAGCGTTCGTAAAGCCACTCATAGATGTTTCAGATCCAAATTTCGGGGTTGTTTGACGCTTTTTATCCGCGCCAGTACCACCAAAAGTGGTTACA
gatgcaccagcagcttcaggagaGGGCCTTCCGAAGGACGACGACTGGAAGGTGTTGCTTGATGCCGCGTTTCCAAAAGCTGTGTGGACTGTTGGACCAT
TTGAAGCGCCACCACTAGATGATGCGAAGGGGTTGTCTGATCGCGAAGAGTTTGCTGCATTTGGAGTAATTTGTTTCTTCCGCACTCGCACACCCACCGA
TTGGCTTCCAAATGATGTTCCGATCGATGACACCGGCGCTGGTCCTCCCGAGCTAACAGCTCCAAAACCACCAGAGTTTTGTGGCAACGAACTCTGCCCA
TGCTTAGGTGCACCAAAGCTACTCTGCGCCCTGCCAAACGCGGCATCATTCCCCCCAAACACTgctccatcgccaccaaAAGTCGAACTATTTCCACCAA
ACGAGGTATTATTCCCTCCAAAGACATTGTCATTTGCACTCCCGCCGAACGCAGGCGCTCGACTCTTGTGCTTTGGTCCTCCAGACGATGCCGATCCAAA
CGTCGTAtgcgatgctgatgctgttgaaggtgttgaagaagctccaTTTTGGCCAAAAGGGCTCGCTCCAAAGCTAGTCTTCGAGTTCCTTCTTGTATTC
TTGTTGCCCTTCTTCTGCCCAAACGGGGTCCCGTTGTTCggaccaccaccaaagccaCCTCCTGGTAGCGGTGGTGCACCAGCAAGACCTCCAGGTGGAA
GGGGTGGTTGGTTACCAAAGCCAGAAGATGACAAAGGAGGGGCACCAGCCATCCCCCCAGGGGGTAGCGGAGGCTGATTGCCAAACCCCGAGCTCTGTCC
GAACGCAGTCTTGGCGCCTGCATTGGGCTGGAACGGGTTCTGAACTGCTGACGTTGGTCCTGGACACGCGACGGGCATCGATCAATACACGCGAGACTTG
TTCAGACTCACAGACGGAGCACAGCATCGTAGCGAGCGCAGGGAGAGCCCCGCCCTATCCGCGGCATCGGCGCATCTAAAACGCTCGCAAACAGCTCGAG
CACTCCCTCCCTCACACAGACACTAGGTCTAACACAACACAAGAGTAGTCTAACTACGCATCTTACCTTGAGTCTGGGCGAATGGGTTGCTGTTCTGCGA
CGTGAAGCCGCCGCCGAAGCCGCCTCCAGGCCCCGAGCTGAACATGGTGTTGTCAGCTTTTTGTTAACGAAAATGGTGAGAGCTTTCACTAAAACGTGAT
GCATCTGTTTTTCCCCAATAATATTAATTTATGGAGTTCAATGAACCTGTCCACTTGGTTTTATAAAGGGAGAAAGATACCTACCCTGAAGCATGTATGT
CTGTTcttacaaaaaccaagtggATAAACATATCGGTTGTTCAAAAAAGGTTTGCCACTTTTTATGTTGATTTTTGAAAGGCGTAACAATCTGTTTCTCT
TTTATATGCTGATAAACGGCAAAAATGAAACAATAATAGGGAGGAATGGGTACTTTGTAATCTCatggtacaatgtaccatTTCAACAAACttatgtggt
ccacatgtGTTGATATTgtgttttgattggttgatgTGTAGTATAGTGAGATCAAGTGATGGAGGACTGGCGTTGGGGAACCACCAATTCTCGTGGCAGC
TCCAGTCCGCCGGCGTTGTTCGCCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAATTTCACGCGTCCAAGGACCTCACCT
ATATGAGAGACCACAGAGAACATGAAACTGACATCGTATATGATCGCGGACTCTAGTTGAAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCAC
TTCCACAAGTACTGGGAGAGCCGAATCAAGACTTGGTTCGACCAGGTAAGATGAGCGACATTTAGCTCCTCAATGGCAATATACAGCAGTCGGATACAGC
CTCCACACACATAGACACGCGCTAGTCGTCCGTGAGCTTCTACGTCTTCCTCTAAAGGACGTTACGTACAGGAGATTGGCTGACTACACAACAGGATTAA
GATGGGCTTAAAAGAGAAGCCCAAAGGACAGACGTGTGCTGTGCTGTGGATAAGGCTGGATCCGACTGCATCTACAGTAGTAGATACTTTCAGTGTGCTG
ATGATTTGTGTATGTGACTATTAAACTCATCAGgcttccaagaagaagacccgTCGTCTGAGACGTAAGGCTAAGGCCGCTGCCATTGCCCCGCGTCCGG
CCGCTGGTCTGCTGCGTCCCGCTGTGCACTGCCCCACGATCAAGTATGGCTCGAAGGTCCGTGCTGGCAAGGGTTTCACGCttgaggagctgaaggaggc
tgGCATCAACCGCAAGCAGGCTCTCAGCATCGGCATTGCCGTTGACTTCCGTCGCACCAACAAGTCGGTGGAGTCGCTCCAGGCTAACGTGCACCGCCTC
AAGGCCTACAAGGCCAAGCTTGTGGTGTTCCCCCGTAAGAACCTGAACAAGCCCAAGAACGGCGACTCGGCTCCGGAGGAGACTAAGAACGCTGTGCAGC
ACACGGGAACGATCCTCCCGATCGTGCGTTCGAGCATCAAGTCCACGACGGCCGTCATCACGCCtgagatgaaggagaagagcgTGTTCACGCAGCTGCG
TGTCGCTCGCGCTGACAAGCGCATCTTCGGTAAGCAGGCCAAGCGTCTGGctgacaagaaggagaagaagtaAGCGTCTGCGTCGGCATCTACTGGCCTG
ATCTCTTGACCTAAATGTTGTCTAGAGAGAAGGTTCTCCTTAAGGTCATTGCGGAAAATTGGAACACAATACATCGCGCATCAAAAAACAAACGTCTTCG
GTTCCTTCCTATCGACAGTGGAATAAGCTAGCATACGCTCAGCTACAGTCACTCTATTGTGTTCATATTTATTCATGATGCATTTCACTTTGTTGGTCGT
ATTTACAGCAGTCTCTCACACTCTTACGTCCGCGTACTCATCTGAATCCGAAAGCAAAGGCTGATTTTCGGGCCCGTCCGAGTAAgctgtcatcgtcctc
gGCTTCGAGTAACTTCCTCCGACGTTGGTGTTTTCCGCCGTGTCCACCTTGTCAGGCAATACGGAGAGGAACGTTAACACCAGCAATTGGCCAACAGATG
AGATCACAACGACCACCCACAGTTGGCTCCAGTCTACATCCTTTGTGACAGGATCGGCTACGACGCCGAGCACTGACACTAGAACGGAAGTGAGAACCCC
AGACACGACGCCTCCAAAGTCCATGAATGACAGATACAGCGCATACGTCAACCCTTGAACATCGGGGTTAGACGGGCAGTAGTACGTCGCCACAACcaac
aattgcagcagtgcgaATTCAgaggtgaaggaggtgatGAACGACTCAGCCGTGCTGAACGTACACACTGAAACGGGAAGATCAACAATGGGTGGGGCTA
GCAACAACCTCGGTAGACCTGCCATAACGGAGCACAccgtggagaagaagaagacactTCGTACGTTGCGGTTCGTGCACCACCTGGCGTACGAAAGACA
CGAGAGAAACCGCCCTACCATGCCTGCGAGAGACATATACTGCAAGCACTCATGctcgttttccagcaacgaAAATGTGTACTGGTACCACACAGTTCCA
TCATCAGGCAGGGCATTacacaggaagaagaagaacatgggCGGGAGAACCGGCACCATAAGTTCcatcttgtgctgcagctctcgcTTGAAAAGCACGC
ACCATGCTGTAACAGAATCTCTCCACGTAGACTCCGCAGTATCCAATTCCTCATGTGACATATCTTCGCTCCATGCAATCTCCATTATAGGTGTCTCTTT
CAACCCAAAAAGACACACAGCAGCCGCTGAGAGCGGTAGTAAACTGGTCCAGCCGATGACTTGTTGAGGCGTGATGGTCTTGTCTTGGTACATTGGTATC
CCCAGCATCAACGCTGCAATAGAAGCAGCATTCTTGGTCCCATTGGCCAATGACTGGACGTGTGCGCTGCTTCTACTGGTGGCATCTCCCGTCGTGAGGT
CCACGAGGAAGATGCCGAGCATGATCTGAGCGAAAGCTTCAGCCACAGCATCCACGAATTTAACCACGAAAGCCCCAGCGATAGAATGAATATAACTGGC
TGTTAACATCAATGATAATGCAGCACAGACTTCACATAGAACGATATAGGACTTGCGTCGGTAACCGAAGAGCGGCAGACTGTCGGACAGCAGACCGTAG
AGAGGCTTGAGGTTCCATGGGAAGAAAGTGACGGAGTAGTAgagcgtggtggtggctggAGGCATGTGGATCACATCAAAGAGCCATTCACCATATGCAG
TCATAGGGAACGTCATAAAGAAGGCGTGCAGGAAGTACAGCGCCAGCAATGCCAGCGGCACGCGCGTCGTCATCGccgtcattgtcgtcatcgtGCTCAT
TGACGAACCAGGTCAAAAGAGGCTTCACTGTATACAAAAGACACGTTAAAACAGTACTTAACAGGGATTTGTTGAAAATAATTCGAATTCGAACGTTAAT
gattttgattggtggaaaattgATGATACTCACCGCCAAGCATTGTATAGGTCATTTGCAGTGGCGGAGGACACTCCAAGCTTAAGAAGATGCCGCGGGA
CGAATTCAACATCGATGAGGCCGAAGACTTTGACGACGGGACGCGTGCAATAACTCACGCTTCCTCAGATtctgaagatggaggtgatAACGACTCGGGG
AGACTGCGGACGTCGCGTAAACAACGACTGCAGGCTGGAGCCAAGAGTGGCAAGCAGCGCGAAGCGGCGTCAGCTCTTCGTGTGCAGAACTGGGATGCAG
GTCTGTTGGAGAGCGCGGAGTATGCTGGAAAAGTGGTGAAGCGGAAGGAACTGGACGGTATGGAGTCGCCTGATGAAGACGCGATGGCTGAATGGTCCGA
TGCTGAGCCTTTCGGAGCTTCTGAGtcagaggaggaggaagagaaagaggctgagaaggaagaagagagtgaagagagtgaagatgaagacgaggaagat
aAGAGTGCTGAGATGTTGATCCGTGGCTTCCAGAAGGAAGACTCGACGAGACTGATGGGAGCTCAGGACAGTGAGaaagtggtggagaaggccaagcacG
CGCGTCACCAGAAGCTGATTTGGGAACGGTGTCTTGAAGTGCAGATTTACACGAAGCGTCTTCTGACAACTACAAAAGTTGTGGCACATGAGACAGTTAA
GGAAGGAAACACgacggatgaagaagctttgaccaaggagaagaagcagcaggttgttGCAGAGCTCTACGCAAGTATCAATGCTGTCTCGGTGTTGCAA
GAGCGATTGTGCAATGTGCCTGAGCTGACGATGCCGTCTGCTGACTCGCCAACTAAGAAACGCAAACGCACGTGTGATGAACTCTGGCAAGATATCACCA
CTTCCAACCGCGCACTGCTTCCCCAGTACAATGAAATCCTCAACACATACACGCGCAAAACCGACCttgcagcaggaagcaaGAACAACCaggcgaagaa
gttcaaggCTGTGAACCAAGATATACTTGCGCAGGTGGAATCTGTCCTCGTGGATCCGCAGAGAATTAAGCGTAAGGCACACGCTCTTGTGGATGCCcca
gaagctgatgctggagaaggagctgaagacatGTTGGACGAACTGATGTACGACGACTCAGACTtctaccagcagcttctgaagGAGTTTATCGAgagcg
gtggaggtggcgcaGGCCAGGATGCCATGGTGAGACGCACTCAtcgcaagaagaagaaagctgtCAACCGCAAGGCGAGCAAGGGCCGCCAATTGCGGTA
CACGGTGCACCCAAAGCTCGAAAATTTCATGTTTCCCGAGCCGTATCCCAAGCCAGAAATGGATGTAGACGAGCTGTTTCGCTCGCTTTTTGGTCAGGTT
CGGCAATAGACAGCTTTAA