Description :
From Genome Similarity Track
Location :
Scaffold_18:588313- 593295
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09537hypothetical protein

Sequence
4982 bases(100 bases per row)
GCAACGAAACAATGCGGTTGTGGTTTTCAGCTGTGTGTGCTTCTATGGAATGTGCCGCATTAATGAAGTTCTTCTGATGAAACGGCGCGATATTCAGCTT
GGACTTCAACGTAAATCACGCAAGAACGGATTAATGATTCGGTTTGGTTGCTTCACTATTCGCGATCGAAAAACGGACCATGACCCGCTCGCCAGTCGCA
CCTACTCGCTTCACCTGCTACCCAAGGAAGAACGAGCTGCTGAAGCATTAACACACTTGAGCCGCTGGTTTGAATATGCACGGACTAAACTGCATCACAA
CTGGAGTGAAGATGATTATGCGTTCCCATCGCTGACCAAGGTTTCCCGTGATTCGAGAAAGCGCGCTCGCGGCGATGACACTACTACTGATGCACGAGCT
TTCGCTAACGTAGGCATCAAGTGGGGTTCTCCCATGTCGGACAGTAGCTTCACCCAAGTGCTAAATATAATTGCCGAAGCTGCTGGCACTAGCAAGAATG
TGCTGGGAGACGACATTTGGTTCACGTCTCATTGCCCAGTACCGGTTCATGTTCGCTCCTGAGAAGCGGAGGTGGTCACTCAAGCTAGTGAAGTGGTGGG
CCGGCTGGGCGCCAAGTGAAAAAGCAGAAACGGTGACGCGGTATCTCCTGGATGACGTGCTCGATCGTGAAGAGAGTTTACTTGGGGACTCGCTAGCACC
GGATGCCATCATGCACACAAGTGCATCACTTGAATGTGTGAGGGATACAGATTACATTTGCCCGCGATATGATGACGAAGAACTGCTGGGAGCGCCAGTG
GAGACTGAAGATAGCTGCACAGCGATGCCCGCTTCAGCTGTCGATCGGCTGAAGCAGGACCTTCTCGAGGGATTGCGCGATATGATTAAAGGTGTTGTAA
CTACATCACAGACTATCGAAGATGTTAAAAGGAATGGTGTAGGCAATGCGGACCCGGTGTCGGATACCTCTTTGTTAATGTCTGAACTTCACGGGGCAAA
GTCCTGGCGCGACTACGTCACGCAGTATTGGGTAGCGAATCCGGCGTGCCACCAGTATCGTGCGGGTGTTGACATGCTGTCACACGAACGCAAGGCACAC
CGATCCCGATTGTCGAGGATGAAAATCATTGCAGAGTTCGTGCGTGGTGAGTTTCAAGACGACTTAGACCGCTTCGAAGCTGAGTTTTCATGCTGTGTAA
ACGGCGACATGACTGTAAACAACATTCTTGCTGCAATTCGTGCGCGTAAAAAACGGTGAATGATTAACTACTCTTGCCGTCCGCAAACGAACAGTCGTCC
GCAAGCGTACTGTCGCCCGCAAATGTACTAGTGTCGTCCGCAAATGTACTAGTGTCGTCCGCAATCGTACCGTCGTGTGCTTTTGTACTATCGTCCTCTT
CTGTACTTAATACTTAATGTTTCGTCGTCCACAGTTGTACTGTCGCCCGCAATTGTACGGGTACTGTATGATTGGACTGTATATTTGGTCGTCCGCAAAT
TTACTGCCGTCCGTAATGGTACGCCTGACTGATATATTGCCCGCAAGTGTACTGTCGCCCGCATCTGTACTCTACGTCAGCAAAAGGTCTTTAGTGTGTA
ACGGTAACATTTCAGTAGCGTAATGTGTTGTTATGCTATTCTCCTTAACTGGACTTAGTGATGACGCTTAGTGTTCGTTGGGATCGTAGTCAACATCGGA
GTCATCCGACGCGCTGTTGAAGTCGCTGGGGTGGTACTCGTCCGCGCTGTCAGATGGATCACTTTCCACCTCTTCCAGCTCTTGACCCCGGGCCTCTTCA
ACATCGGGTGGACCTTCATACTCAAAGGCATTATCATCGTGTAGACAGGCTTCCTCTTCGTCTTCGTCAACATCTTCATCATCGACTAACTGACACGGAA
ATGGGTACTGGCATACTGTAACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTCCTCTTGGGCGGACCTTTCCACGTAAGAAAAAAGTGTAATATGTACTTAGAATTTGTGGCATTTTGCGTTTTGG
TATGGACAAATTCTAGCACATCAGATTTGGAATGCGTTGTGATTTATGCAGAAATTTTGGGTCACCCACAAAATTTTTGCCGAAGATTTTACTCAAAGGT
GAGCCTATTTCTAGGATGTTTAAATAAAAAGGGTGTGCACGCAAAACACTACCTAAAAGCCTAAGATGGACGCTATCTTGGCTCGCGTAGGCGTAAGCGA
CACAGCGCTTCGTGCGCACTGTTCGAATGCCGTCCACGATGAGCTGCAGCAGGCGGAAAAGAGATTGCAAAAAGCGCTGGCAGCTCTGAAGCGCGCGCTG
GAAGTGGCTGAGGCTTCGCGGGAGTTGTACAAGTCTTCACAAGCGCTGGTGGACGAGTCGCCCGACGTTTCCAGCATGCTCTCGCGTGTTGTGAGCTCTT
GCAACGCAATTGGACCGCTCACAAGAAAATTACACCAGACTGTGAGTTCTCCTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN