Description :
From Genome Similarity Track
Location :
Scaffold_542:5882- 7526
Sequence
1644 bases(100 bases per row)
AANNNNNNNNNNTGCATCTTCGCTTCAGAAGAGATTCCCTTTCTGGGATGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGTTAAGGTAAGGTCCA
TAGTCGATTGGCCGGTTCTAAAGAACCAAAAAGATCTACAGAAGTGACTTGGCCTTGCCTATACTTGCATAAGTATAGTGCGAAATACGCAGATATAGCT
CGGACATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAGCACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCACGCGC
CAATACTGGCTTTGCCCAATTCTGATCGTCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGG
ATGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTGATGACAAAGCGCTACTTGCTATGAAGTACGCTCTA
GTCAAATTCAGAGTACATCTGCTTGGGTCCAAGCCATTTGTGATCTATACAGATCATACATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGA
GAATGGATCGTTGGCTCTCATTGTTTGCCGAATATAACTTCGAAGTGAAGTATAAGTCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCGATC
TGACTATGATCTTGCTCACGTCACTACGCTCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTGTGCTACGTGCTCT
TGGGAGCGAGGAGTTGAAAGACTCGGACATAGAATTCTCGGCACGTTTACGTGCGAGACTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGC
ACGGATATTGAGGATAACCCTCGTTTGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCT
CGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGTTGGCCCAAACTATACAAGTGGGTGAGCAACTATGTGCGTACATATAAAGCGTGTTAA
CGAGTTAAACCCTCAGCACATGCGGCGGCGCCGCTAGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATAAGTATGGACTTTGTGTTCGGCCTAC
CGAAAGATTCGGAGGCAACACTGGCATTGTGGTCTTTGTTGACCGACTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATCCCGAAGGT
ACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAGCATGGTTTGCCAGTGACAATTGTCTGTGATAGAGATCCCCGCTTCACTGGAAAGTTTTGGAAGT
CCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCGCAGCGGGTCATCCGCAGATGGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACAT
TGTGCGCAGTGTTTGCGCTGATACGCCCAAGCGTTGGATCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTGTTCATGCCTTTACAGGCTAT
ATACTCCTTTCTACGTAAACGGTCTCACCCACCCTCTCGTTCTG