Description :
From Genome Similarity Track
Location :
Scaffold_624:5881- 6884
Transcript NameFunction/comments
g15687.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTA
CGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGA
GCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAAACTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCC
TCCAAGCGAGACTCAAGATTTGGTTGACCAAACCCGGGGCGTCTTTCCGCCCCTCACCCCACCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCT
GGATCATCCAGCGAATTGTTGATCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGGTTTCCTCCCCAACACGATACGTGAGA
CACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCT
GCAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAATCTGGCGCGCAGGGTCTTCAGGTCGTCAGGTACACACATGG
ACGTGTACCCGTTGATGTAATGGGTCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTATTTAACTTAAGTTTAGTATACTT
GTATCTGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAAC
TGATATTACTAATGAGAGGTTATGCCACTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGTTGTTACTTTCTACCAGTCAT
ATG